ID: 1006054956

View in Genome Browser
Species Human (GRCh38)
Location 6:31377463-31377485
Sequence ACTTCTGATCCCCTAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054944_1006054956 26 Left 1006054944 6:31377414-31377436 CCCTGGCCTGTACCCTAGTGCTT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054946_1006054956 20 Left 1006054946 6:31377420-31377442 CCTGTACCCTAGTGCTTTGTATG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054945_1006054956 25 Left 1006054945 6:31377415-31377437 CCTGGCCTGTACCCTAGTGCTTT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054948_1006054956 14 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1006054949_1006054956 13 Left 1006054949 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 1
2: 6
3: 149
4: 1971
Right 1006054956 6:31377463-31377485 ACTTCTGATCCCCTAGGACTGGG 0: 1
1: 0
2: 0
3: 7
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054956 Original CRISPR ACTTCTGATCCCCTAGGACT GGG Intergenic