ID: 1006054957

View in Genome Browser
Species Human (GRCh38)
Location 6:31377472-31377494
Sequence CGGGCTGCTCCCAGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054957_1006054971 28 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054971 6:31377523-31377545 GAAGGCTGCTTCATGCTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006054957_1006054965 -4 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054965 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1006054957_1006054968 6 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054957_1006054972 29 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054957_1006054969 10 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054957 Original CRISPR CGGGCTGCTCCCAGTCCTAG GGG (reversed) Intergenic