ID: 1006054959

View in Genome Browser
Species Human (GRCh38)
Location 6:31377474-31377496
Sequence GGCGGGCTGCTCCCAGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 620}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054959_1006054971 26 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054971 6:31377523-31377545 GAAGGCTGCTTCATGCTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006054959_1006054972 27 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054959_1006054969 8 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054959_1006054965 -6 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054965 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG 0: 1
1: 0
2: 0
3: 12
4: 107
1006054959_1006054968 4 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054959 Original CRISPR GGCGGGCTGCTCCCAGTCCT AGG (reversed) Intergenic