ID: 1006054960

View in Genome Browser
Species Human (GRCh38)
Location 6:31377477-31377499
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054949_1006054960 27 Left 1006054949 6:31377427-31377449 CCTAGTGCTTTGTATGGCTGTGG 0: 1
1: 1
2: 6
3: 149
4: 1971
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1006054953_1006054960 -5 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1006054952_1006054960 -4 Left 1006054952 6:31377458-31377480 CCCCTACTTCTGATCCCCTAGGA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1006054948_1006054960 28 Left 1006054948 6:31377426-31377448 CCCTAGTGCTTTGTATGGCTGTG 0: 1
1: 0
2: 3
3: 11
4: 164
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227
1006054954_1006054960 -6 Left 1006054954 6:31377460-31377482 CCTACTTCTGATCCCCTAGGACT 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1006054960 6:31377477-31377499 AGGACTGGGAGCAGCCCGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054960 Original CRISPR AGGACTGGGAGCAGCCCGCC TGG Intergenic