ID: 1006054966

View in Genome Browser
Species Human (GRCh38)
Location 6:31377492-31377514
Sequence TCCTGATGGTCTCCCCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054966_1006054969 -10 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054966_1006054971 8 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054971 6:31377523-31377545 GAAGGCTGCTTCATGCTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006054966_1006054972 9 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054966_1006054973 26 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054973 6:31377541-31377563 CAAGGGCAGAGTTAAGTCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054966 Original CRISPR TCCTGATGGTCTCCCCCAGG CGG (reversed) Intergenic