ID: 1006054967

View in Genome Browser
Species Human (GRCh38)
Location 6:31377495-31377517
Sequence ACATCCTGATGGTCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054967_1006054971 5 Left 1006054967 6:31377495-31377517 CCTGGGGGAGACCATCAGGATGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1006054971 6:31377523-31377545 GAAGGCTGCTTCATGCTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006054967_1006054972 6 Left 1006054967 6:31377495-31377517 CCTGGGGGAGACCATCAGGATGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054967_1006054973 23 Left 1006054967 6:31377495-31377517 CCTGGGGGAGACCATCAGGATGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1006054973 6:31377541-31377563 CAAGGGCAGAGTTAAGTCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054967 Original CRISPR ACATCCTGATGGTCTCCCCC AGG (reversed) Intergenic