ID: 1006054968

View in Genome Browser
Species Human (GRCh38)
Location 6:31377501-31377523
Sequence GGAGACCATCAGGATGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054954_1006054968 18 Left 1006054954 6:31377460-31377482 CCTACTTCTGATCCCCTAGGACT 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054958_1006054968 5 Left 1006054958 6:31377473-31377495 CCCTAGGACTGGGAGCAGCCCGC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054957_1006054968 6 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054953_1006054968 19 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054952_1006054968 20 Left 1006054952 6:31377458-31377480 CCCCTACTTCTGATCCCCTAGGA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190
1006054959_1006054968 4 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054968 6:31377501-31377523 GGAGACCATCAGGATGTCTATGG 0: 1
1: 0
2: 1
3: 27
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054968 Original CRISPR GGAGACCATCAGGATGTCTA TGG Intergenic