ID: 1006054969

View in Genome Browser
Species Human (GRCh38)
Location 6:31377505-31377527
Sequence ACCATCAGGATGTCTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054954_1006054969 22 Left 1006054954 6:31377460-31377482 CCTACTTCTGATCCCCTAGGACT 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054966_1006054969 -10 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054957_1006054969 10 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054964_1006054969 -9 Left 1006054964 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054952_1006054969 24 Left 1006054952 6:31377458-31377480 CCCCTACTTCTGATCCCCTAGGA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054953_1006054969 23 Left 1006054953 6:31377459-31377481 CCCTACTTCTGATCCCCTAGGAC 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054959_1006054969 8 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206
1006054958_1006054969 9 Left 1006054958 6:31377473-31377495 CCCTAGGACTGGGAGCAGCCCGC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1006054969 6:31377505-31377527 ACCATCAGGATGTCTATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054969 Original CRISPR ACCATCAGGATGTCTATGGA AGG Intergenic