ID: 1006054970

View in Genome Browser
Species Human (GRCh38)
Location 6:31377506-31377528
Sequence GCCTTCCATAGACATCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054970_1006054973 12 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054973 6:31377541-31377563 CAAGGGCAGAGTTAAGTCTTTGG 0: 1
1: 0
2: 2
3: 15
4: 167
1006054970_1006054974 24 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054974 6:31377553-31377575 TAAGTCTTTGGTATAGAGACTGG 0: 1
1: 0
2: 0
3: 11
4: 272
1006054970_1006054972 -5 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054970_1006054971 -6 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054971 6:31377523-31377545 GAAGGCTGCTTCATGCTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 129
1006054970_1006054975 28 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054975 6:31377557-31377579 TCTTTGGTATAGAGACTGGTTGG 0: 1
1: 0
2: 1
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054970 Original CRISPR GCCTTCCATAGACATCCTGA TGG (reversed) Intergenic