ID: 1006054972

View in Genome Browser
Species Human (GRCh38)
Location 6:31377524-31377546
Sequence AAGGCTGCTTCATGCTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 8, 3: 17, 4: 169}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006054957_1006054972 29 Left 1006054957 6:31377472-31377494 CCCCTAGGACTGGGAGCAGCCCG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054964_1006054972 10 Left 1006054964 6:31377491-31377513 CCCGCCTGGGGGAGACCATCAGG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054958_1006054972 28 Left 1006054958 6:31377473-31377495 CCCTAGGACTGGGAGCAGCCCGC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054966_1006054972 9 Left 1006054966 6:31377492-31377514 CCGCCTGGGGGAGACCATCAGGA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054970_1006054972 -5 Left 1006054970 6:31377506-31377528 CCATCAGGATGTCTATGGAAGGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054959_1006054972 27 Left 1006054959 6:31377474-31377496 CCTAGGACTGGGAGCAGCCCGCC 0: 1
1: 0
2: 2
3: 49
4: 620
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169
1006054967_1006054972 6 Left 1006054967 6:31377495-31377517 CCTGGGGGAGACCATCAGGATGT 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1006054972 6:31377524-31377546 AAGGCTGCTTCATGCTACAAGGG 0: 1
1: 0
2: 8
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006054972 Original CRISPR AAGGCTGCTTCATGCTACAA GGG Intergenic