ID: 1006055000

View in Genome Browser
Species Human (GRCh38)
Location 6:31377691-31377713
Sequence CCTCAGCGGGAGGCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 648}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006055000_1006055009 17 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055009 6:31377731-31377753 GCAGTTGTTCTTTGGCCTCCGGG 0: 1
1: 0
2: 1
3: 20
4: 177
1006055000_1006055010 27 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055010 6:31377741-31377763 TTTGGCCTCCGGGACACCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1006055000_1006055011 28 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055011 6:31377742-31377764 TTGGCCTCCGGGACACCGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1006055000_1006055005 -7 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055005 6:31377707-31377729 GCTGAGGTCTTGAAACCATCAGG 0: 1
1: 0
2: 1
3: 12
4: 105
1006055000_1006055007 9 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055007 6:31377723-31377745 CATCAGGAGCAGTTGTTCTTTGG 0: 1
1: 0
2: 2
3: 22
4: 114
1006055000_1006055008 16 Left 1006055000 6:31377691-31377713 CCTGCTGCAGCCTCCCGCTGAGG 0: 1
1: 0
2: 2
3: 46
4: 648
Right 1006055008 6:31377730-31377752 AGCAGTTGTTCTTTGGCCTCCGG 0: 1
1: 0
2: 1
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006055000 Original CRISPR CCTCAGCGGGAGGCTGCAGC AGG (reversed) Intergenic
900336428 1:2166305-2166327 GCTCCTCGGGAGGCTGAAGCCGG + Intronic
900746263 1:4362672-4362694 GGTCAGTGGGAGGCTGCAGGGGG + Intergenic
900793079 1:4692223-4692245 CAGCGGCGGGAGGCAGCAGCAGG - Intronic
901062915 1:6481417-6481439 GCTACGCGGGAGGCTGAAGCAGG + Intronic
901074035 1:6541291-6541313 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
901204715 1:7487597-7487619 CCTCACCTGCAGGCTGCAGCAGG - Intronic
901286414 1:8082756-8082778 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
901287636 1:8093804-8093826 CCTCACAGGGAGGCTCCACCTGG + Intergenic
901440281 1:9273508-9273530 CCACTGCTGGACGCTGCAGCAGG + Intergenic
901769778 1:11524358-11524380 CCTCTGAGGGAGACTCCAGCAGG - Intronic
901777269 1:11568760-11568782 GCTCTTCGGGAGGCTGCGGCAGG - Intergenic
901810589 1:11764940-11764962 GCTACTCGGGAGGCTGCAGCAGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902451558 1:16499584-16499606 CCGCAGGGGGACTCTGCAGCCGG - Intergenic
902501343 1:16913776-16913798 CCGCAGGGGGACTCTGCAGCCGG + Intronic
903000498 1:20262182-20262204 CCCCAGCGGGAGGGTGGAGAAGG - Intergenic
903209164 1:21806588-21806610 GCTCCTTGGGAGGCTGCAGCAGG - Intergenic
903327033 1:22575060-22575082 GCTACTCGGGAGGCTGCAGCAGG - Intronic
903464562 1:23543171-23543193 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
904173485 1:28608641-28608663 GCTAATCGGGAGGCTGAAGCAGG + Intronic
904662096 1:32093065-32093087 CCTCAGCTGCAAGCTGCAGTGGG + Intronic
904762898 1:32818013-32818035 GCTCGGCGGGAGGCTGTTGCTGG + Exonic
905644539 1:39616236-39616258 CTTCAGGGGCAGCCTGCAGCTGG - Intergenic
905694342 1:39963844-39963866 GCTCCTCGGGAGGCTGAAGCGGG - Intronic
906052643 1:42887693-42887715 CGTGTGCGGGAGGCTGCGGCAGG - Intergenic
906767222 1:48444656-48444678 CCTGAGCGGGTTGCTGCTGCTGG - Intronic
906859829 1:49347746-49347768 GCTACTCGGGAGGCTGCAGCAGG + Intronic
906980115 1:50620966-50620988 CCTCAGGCAGAGGCTGGAGCAGG + Intronic
907086498 1:51680140-51680162 CCTCCTCGGGAGGCTGAGGCTGG + Intronic
908131206 1:61077143-61077165 CCTCCGCCGCAGGCTGCCGCCGG + Intronic
908999624 1:70202964-70202986 CCTGAGTTGGAGGCTGCAGTGGG - Intronic
909242915 1:73237912-73237934 TGTCAGCTGGAGGCTGCAACTGG - Intergenic
910257015 1:85259049-85259071 TCTCAGGGAGAAGCTGCAGCGGG + Intronic
910316932 1:85896604-85896626 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
911222244 1:95261540-95261562 ACACAGGAGGAGGCTGCAGCAGG - Intergenic
911275229 1:95852468-95852490 CCACAGCGGGAAGGTGCAGGTGG + Intergenic
911345410 1:96691108-96691130 CCTGAGCGTGTGGCTGCTGCTGG - Intergenic
912681080 1:111729494-111729516 CCTAATTTGGAGGCTGCAGCGGG + Intronic
912918284 1:113840097-113840119 CCTATTCGGGAGGCTGAAGCAGG + Intronic
913966373 1:143380842-143380864 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
914060746 1:144206449-144206471 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
914118404 1:144759920-144759942 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
914244043 1:145872806-145872828 CCTGAGCCAGCGGCTGCAGCGGG - Exonic
914725237 1:150321671-150321693 CCGAAGCGGGAGGGTTCAGCGGG + Intronic
914913691 1:151805359-151805381 CAGCAGCGGCAGGCAGCAGCCGG - Exonic
918963127 1:191306133-191306155 GCTCTGCATGAGGCTGCAGCTGG + Intergenic
919028376 1:192206403-192206425 CCTCTTTGGGAGGCTGCGGCGGG - Intergenic
919791945 1:201297357-201297379 CCTCAGGGAGAGGAAGCAGCTGG + Intronic
920058999 1:203214668-203214690 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
920627727 1:207619269-207619291 CCTACCCGGGAGGCTGAAGCAGG + Intronic
921062340 1:211596243-211596265 GCTCTGTGGGGGGCTGCAGCAGG - Intergenic
921444309 1:215226958-215226980 TCTCAGCAGGAAGATGCAGCCGG - Intronic
922510780 1:226165280-226165302 CCTACTCGGGAGGCTGAAGCAGG - Intronic
922543294 1:226435147-226435169 CTGAAGCGGGAGGCTGAAGCAGG - Intergenic
922661221 1:227432048-227432070 CCACCGCTGCAGGCTGCAGCTGG - Intergenic
923499120 1:234550053-234550075 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
923740677 1:236652025-236652047 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
924324221 1:242879166-242879188 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
924574398 1:245266616-245266638 GCTAATCGGGAGGCTGAAGCAGG - Intronic
924753455 1:246919599-246919621 CCTACTCGGGAGGCTGAAGCAGG + Intronic
924775346 1:247111902-247111924 CCGGAGCGCGAGGCCGCAGCGGG + Exonic
1062981843 10:1730400-1730422 CTTCCGCGTGAGGCTTCAGCTGG + Intronic
1063470209 10:6278385-6278407 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1064195575 10:13241557-13241579 GCTCCTCGGGAGGCTGCAGTGGG - Intergenic
1064759566 10:18604068-18604090 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1065896353 10:30166266-30166288 ACTCTTCGGGAGGCTGAAGCAGG - Intergenic
1067015112 10:42752805-42752827 GCTCCTCGGGAGGCTGAAGCAGG - Intergenic
1067570899 10:47370151-47370173 GCTCAGAGGCAGGCTGCAGTAGG - Intronic
1067690514 10:48498536-48498558 GGGCAGAGGGAGGCTGCAGCGGG - Intronic
1068036039 10:51760866-51760888 GCACCGCGGGAGGCTGAAGCGGG + Intronic
1068359031 10:55952085-55952107 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
1069004102 10:63298044-63298066 CCCCATTGTGAGGCTGCAGCTGG - Intronic
1069042483 10:63709965-63709987 GCACATTGGGAGGCTGCAGCAGG + Intergenic
1070486050 10:76932800-76932822 TCTCAGCGGTAGACTGGAGCAGG - Intronic
1070727732 10:78803579-78803601 CATGAGCGTGAGGCTGCAGGGGG + Intergenic
1072032146 10:91531046-91531068 CCTCAGTGTGAGGCTGCAGGAGG + Intergenic
1072583149 10:96757721-96757743 TCCCAGCGGGAGGCTGAGGCGGG + Intergenic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1073414436 10:103369088-103369110 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1074326569 10:112456308-112456330 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1074618681 10:115094166-115094188 CCTCAGCGCGCGGCGGGAGCGGG + Intronic
1074735959 10:116433000-116433022 GCTACGCGGGAGGCTGAAGCAGG + Intronic
1074979472 10:118608248-118608270 GCTCTGTGTGAGGCTGCAGCTGG + Intergenic
1075755838 10:124810692-124810714 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1076213886 10:128676914-128676936 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1076342916 10:129761855-129761877 CCTGAGGAGGGGGCTGCAGCAGG + Intronic
1076410449 10:130245235-130245257 AGGCAGCGGGAGGCTGCTGCGGG + Intergenic
1076615380 10:131751201-131751223 CCTCGGGGAGGGGCTGCAGCCGG - Intergenic
1076736131 10:132459917-132459939 ACTCAGCTGGTGGCTGCTGCTGG - Intergenic
1076872258 10:133199864-133199886 GCTCTCCGGGAGGCTGCAGGGGG + Intronic
1077048192 11:555355-555377 CCTCTGCGGGAGGCGACGGCAGG + Exonic
1077639335 11:3867319-3867341 CCTGAGCAGGTGGCTGCAGTAGG + Intronic
1077655023 11:4010415-4010437 GCACATCGGGAGGCTGAAGCAGG - Intronic
1078836163 11:15032136-15032158 ACTCAGCAGGATGCAGCAGCTGG + Intronic
1078836640 11:15036411-15036433 CCTCAGCAGGATGCAGCAGCTGG + Intronic
1079099837 11:17534205-17534227 CTTCATAGAGAGGCTGCAGCTGG + Intronic
1079135362 11:17773446-17773468 CCTCGGTGGGAGGCTGTTGCTGG - Intronic
1080277954 11:30524139-30524161 ACTCAGTGGGAGGCTGAGGCAGG + Intronic
1080669801 11:34365662-34365684 GCTAATCGGGAGGCTGAAGCAGG - Intergenic
1080678158 11:34446988-34447010 ACACTTCGGGAGGCTGCAGCAGG - Intronic
1081522877 11:43899618-43899640 GCTCGGCGGGAGGGTGGAGCTGG - Intronic
1081873164 11:46392230-46392252 CCCCAGCGGGAGGCTGCGGGTGG + Intergenic
1081921714 11:46784254-46784276 GCTATGCGGGAGGCTGAAGCAGG + Intronic
1082039715 11:47674844-47674866 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1082260646 11:50074327-50074349 GTCCACCGGGAGGCTGCAGCTGG + Intergenic
1083757095 11:64797473-64797495 ACACAGAGGGAGGCTGGAGCTGG - Intronic
1084185904 11:67471055-67471077 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
1084289222 11:68151178-68151200 ACTCAGCAGGAGGCTGAGGCAGG + Intergenic
1084308051 11:68299317-68299339 GCTCAGGGGGAGGCTGGAGGTGG + Intergenic
1084495866 11:69502700-69502722 CCTCAGTGGGCAGATGCAGCTGG - Intergenic
1084502792 11:69544741-69544763 CCACAGAGCGAGGCTGAAGCGGG + Intergenic
1084873372 11:72112649-72112671 CCGCGCCGGGAGGCTGCTGCCGG + Exonic
1084936518 11:72589937-72589959 CACCAGCAGGAGGCAGCAGCGGG + Exonic
1085322546 11:75583713-75583735 CCTCCCCGGGCGGCTGCAGCAGG + Intergenic
1085527562 11:77173076-77173098 ACTCTGCGGGGGGTTGCAGCAGG + Intronic
1086515523 11:87607799-87607821 CCTGCTCGGGAGGCTGAAGCAGG + Intergenic
1086946969 11:92853268-92853290 GCTCTGTGTGAGGCTGCAGCTGG + Intronic
1087327190 11:96738569-96738591 CCTCAGGCAGAGGCTGCTGCTGG + Intergenic
1089128295 11:116192875-116192897 CTTCAGCAGGAGGTGGCAGCGGG - Intergenic
1090194701 11:124804768-124804790 CGTCAGCTGGTGGCTGGAGCTGG - Intergenic
1091603768 12:1933814-1933836 ACTCCACGGGTGGCTGCAGCCGG - Intergenic
1092111809 12:5969712-5969734 CATCAGTGGGAAGGTGCAGCCGG + Intronic
1092234288 12:6796511-6796533 CCTCAAAGGAAGGCTGGAGCAGG - Intronic
1092259862 12:6947006-6947028 CCTAAGCAGGAGGCAGAAGCAGG - Intronic
1092339215 12:7661092-7661114 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1094296728 12:28915123-28915145 CCTCAGGCAGAAGCTGCAGCTGG - Intergenic
1095361772 12:41350854-41350876 CCTGAGAGGGAGGCTGCTTCTGG - Intronic
1095954292 12:47797577-47797599 CCTGAGGGGGAGGCTGCAGCGGG + Intronic
1096312070 12:50530186-50530208 GCTCCTCGGGAGGCTGAAGCGGG - Intronic
1097158206 12:57027958-57027980 CCACAGCTGGGGCCTGCAGCAGG - Intronic
1097281368 12:57846853-57846875 CCCCAGCGGGAAGCTCCAGCTGG - Intergenic
1097374090 12:58819588-58819610 CCCCACCTGGAGGCTGCCGCAGG + Intergenic
1097823692 12:64153359-64153381 CCTACTCGGGAGGCTGAAGCAGG + Exonic
1098431093 12:70420939-70420961 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1098813395 12:75124992-75125014 GCTATGCGGGAGGCTGAAGCAGG + Intronic
1099550146 12:84033413-84033435 GCTCCGTGAGAGGCTGCAGCTGG - Intergenic
1100460297 12:94792907-94792929 TCTCAGCCGAGGGCTGCAGCAGG - Intergenic
1103078274 12:118003016-118003038 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1103664608 12:122553043-122553065 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1103685568 12:122729712-122729734 CCTGAGGCGGAGGCAGCAGCTGG - Exonic
1103716824 12:122949975-122949997 CGGCAGCGGGAGGGGGCAGCCGG - Intronic
1103883699 12:124185706-124185728 GCTACGCGGGAGGCTGCAGCAGG + Intronic
1104098565 12:125584159-125584181 AATCAGCAGGCGGCTGCAGCAGG + Intronic
1104277601 12:127344070-127344092 AATCAGCAGGCGGCTGCAGCAGG - Intergenic
1104623417 12:130335172-130335194 GCTCAGCGGGAGGTTGCTGAGGG - Intergenic
1104846757 12:131850879-131850901 GCTCAGGGGAGGGCTGCAGCAGG - Intronic
1105010397 12:132752226-132752248 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1106034544 13:26031850-26031872 CCTGAGCGGGTTGCTGCTGCTGG + Intergenic
1106078633 13:26482356-26482378 CCTCAGCTGGAGGCAGTAGCTGG - Intergenic
1106253413 13:28001280-28001302 GCTCAGGGTGAGGCTACAGCTGG + Intergenic
1106471088 13:30054878-30054900 CCCCAGCGGGTTGCTGCTGCTGG - Intergenic
1106938792 13:34753509-34753531 CCTGAGCGGGTTGCTGCTGCTGG - Intergenic
1107496028 13:40926919-40926941 GCTCCGCGGGAGGCTGAGGCAGG + Intergenic
1107823100 13:44304048-44304070 CCCCAGGGGGATGATGCAGCAGG - Intergenic
1109500708 13:63233913-63233935 CCTGAGCGGGTTGCTGCTGCTGG - Intergenic
1110079236 13:71290061-71290083 CCCCAGCGGGTTGCTGCTGCTGG + Intergenic
1110430693 13:75419648-75419670 CCACAGAGGGAGGCTGAAGTGGG + Intronic
1111157056 13:84341339-84341361 GCACATCGGGAGGCTGAAGCTGG - Intergenic
1112309855 13:98308778-98308800 GCTACTCGGGAGGCTGCAGCGGG - Intronic
1112407650 13:99135367-99135389 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1113495433 13:110724704-110724726 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1114180181 14:20360124-20360146 CCGAGGCGGGAGGCTGAAGCAGG - Intergenic
1115216724 14:31020792-31020814 CCTACTCGGGAGGCTGCAGCAGG + Intronic
1115620094 14:35132673-35132695 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1117137194 14:52747743-52747765 CCTCAATGGGAGGCTGAGGCAGG + Intronic
1117744434 14:58854021-58854043 GCTATTCGGGAGGCTGCAGCAGG - Intergenic
1119248858 14:73135477-73135499 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1120975317 14:90243042-90243064 GCTCCTCGGGAGGCTGAAGCAGG + Intergenic
1120983693 14:90314030-90314052 CCTCAGGGGCGGTCTGCAGCTGG - Intronic
1121405622 14:93717675-93717697 CCTGAGGGTGAGGCTGGAGCGGG + Intergenic
1121515250 14:94545329-94545351 CCTCAGCTGGAGGCTGGAGAGGG - Intergenic
1121792997 14:96712781-96712803 GCTCCTCGGGAGGCTGAAGCAGG + Intergenic
1122001603 14:98661418-98661440 GCTCATCGGGAGGCTGAGGCAGG - Intergenic
1124371114 15:29105299-29105321 CCTCAGCAGGGGGCTGCGGCAGG - Intronic
1125149950 15:36520136-36520158 CATCAGCAGGAGGCTGAGGCAGG + Intergenic
1125853689 15:42928525-42928547 CCTCAGTAGGAGGCAGTAGCTGG + Intergenic
1126420419 15:48466542-48466564 CCTCACTGGGATGATGCAGCAGG - Intronic
1126788454 15:52198691-52198713 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1126795801 15:52259851-52259873 CCTCCCCAGGAGGCAGCAGCAGG + Intronic
1127367568 15:58305995-58306017 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1127978823 15:64018902-64018924 CCTCAGAGGCAGTCAGCAGCAGG - Intronic
1127992031 15:64126689-64126711 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
1128081567 15:64860296-64860318 CCTCAGCTGGAAGCAGCAGGTGG + Intronic
1128103163 15:65022339-65022361 GCTATTCGGGAGGCTGCAGCAGG + Intronic
1128168570 15:65489827-65489849 GCTACGCGGGAGGCTGAAGCAGG - Intronic
1128513034 15:68325362-68325384 CCTCAGGGTGAGTCTGCAGGTGG + Intronic
1128800294 15:70492820-70492842 TCTCAGTGGGAGGCTGAATCAGG - Intergenic
1129193622 15:73951890-73951912 CCTCGGCGGGAGGCTGCCCGGGG - Exonic
1130102043 15:80901588-80901610 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1130196952 15:81788542-81788564 CCTACGCGGGAGGCTGAGGCAGG + Intergenic
1130460473 15:84155786-84155808 CCTGAGCAGGAGGCTGCACTGGG + Intergenic
1130567977 15:85014256-85014278 ACTCCTCGGGAGGCTGAAGCAGG - Intronic
1130960420 15:88655238-88655260 ACTCAGCAGGTGGCTGGAGCTGG - Intronic
1131245578 15:90789359-90789381 CCTCATCTGGAGGCTGCAGGCGG + Intronic
1131342387 15:91614502-91614524 CCACAGCGAGGGGCTGCAGAAGG + Intergenic
1131522709 15:93128193-93128215 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1131594278 15:93781197-93781219 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
1131936869 15:97515945-97515967 TCTAAATGGGAGGCTGCAGCAGG - Intergenic
1132092974 15:98960605-98960627 CCTCAGCGCGAGCCTCCTGCAGG - Exonic
1132215835 15:100061035-100061057 CCTCCGTGGGAGGTTGGAGCCGG - Intronic
1132303365 15:100789906-100789928 CCTGCTCGGGAGGCTGAAGCAGG + Intergenic
1132365103 15:101251510-101251532 CCTCCGCGGGCGGGGGCAGCGGG - Exonic
1132387102 15:101408428-101408450 TCTCTGCGGGTGTCTGCAGCAGG + Intronic
1132511535 16:344598-344620 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1132608522 16:803504-803526 TCCTAGCGGGAAGCTGCAGCAGG + Intergenic
1132713276 16:1278621-1278643 CCTCAGCGGGAGGGTCCCCCTGG - Intergenic
1132762167 16:1514256-1514278 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1132897656 16:2236613-2236635 ACTGCGCGGGAAGCTGCAGCCGG - Exonic
1132996238 16:2824852-2824874 CCTCCCTGGGAGGCTGCAGAGGG - Intronic
1133125016 16:3641140-3641162 CCACAGCGTGGAGCTGCAGCAGG - Intronic
1133130140 16:3671738-3671760 CCTCAGCCGGGAGCTGCTGCAGG - Exonic
1134059663 16:11191462-11191484 CCTCCCCAGGAGGCTTCAGCAGG + Intergenic
1134181002 16:12047767-12047789 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1134776613 16:16859010-16859032 GCTCCTCGGGAGGCTGAAGCAGG - Intergenic
1135035169 16:19071245-19071267 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1136312728 16:29424077-29424099 ACTACTCGGGAGGCTGCAGCAGG - Intergenic
1136315805 16:29454211-29454233 CCTCCGCGAGAAGCTGCAGCGGG - Exonic
1136430382 16:30193553-30193575 CCTCCGCGAGAAGCTGCAGCGGG - Exonic
1137266467 16:46872975-46872997 GCTAATCGGGAGGCTGAAGCAGG + Intergenic
1137856520 16:51799901-51799923 GCTCAGCCAGAGGCTGCAGAGGG + Intergenic
1139140797 16:64260101-64260123 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1139268775 16:65663053-65663075 CCTACTCGGGAGGCTGAAGCAGG + Intergenic
1139282356 16:65781542-65781564 CCTGAGCAGGAAGCTGCATCTGG + Intergenic
1139873875 16:70129454-70129476 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1140037181 16:71380418-71380440 GCTCGGCGGGAGGCTGAGGCAGG - Intronic
1140083363 16:71772240-71772262 CCTCACCTGGAGGCTGAGGCAGG - Intronic
1140361906 16:74351686-74351708 CCTACTCGGGAGGCTGAAGCAGG + Intergenic
1140825663 16:78703505-78703527 ACTCAGAGGGAGGCTGAAGCAGG + Intronic
1141160891 16:81628373-81628395 CCTTAGCACAAGGCTGCAGCTGG + Intronic
1141199201 16:81883958-81883980 TCACAGCGGGAGGCTGCTGCCGG + Intronic
1141317182 16:82973643-82973665 CTCCACCTGGAGGCTGCAGCGGG + Intronic
1141664033 16:85456714-85456736 CCAGGGAGGGAGGCTGCAGCAGG + Intergenic
1141863047 16:86731019-86731041 CTGCAGCGGGAGGATGGAGCTGG + Intergenic
1142330810 16:89452144-89452166 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1142585664 17:971596-971618 GCTCCTCGGGAGGCTGCGGCAGG + Intronic
1142729339 17:1840953-1840975 GCTACGCGGGAGGCTGCAGCAGG + Intronic
1142739525 17:1923043-1923065 GCTCATCGGGAGGCTGAGGCAGG - Intergenic
1142840971 17:2629995-2630017 CCTGAACAGGAGGCTGCAGATGG + Intronic
1142844960 17:2667220-2667242 ACTTAACGGGAGGCTGAAGCAGG + Intronic
1142978159 17:3657256-3657278 CCTGAGCAGGCGGGTGCAGCTGG + Intronic
1143260230 17:5593256-5593278 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1144329882 17:14213584-14213606 CCACAGCAGGAGACTGCAACTGG - Intergenic
1144483185 17:15644295-15644317 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1144915500 17:18720734-18720756 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
1145072181 17:19820158-19820180 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1145753168 17:27369634-27369656 GCTACTCGGGAGGCTGCAGCTGG + Intergenic
1146043669 17:29483322-29483344 CCACTGCGGGAGGCTGAGGCAGG - Intronic
1146415690 17:32630682-32630704 GCTAATCGGGAGGCTGAAGCAGG - Intronic
1146723652 17:35140700-35140722 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1146890037 17:36500997-36501019 CCTCAGCAGGAGGGGGCAGGGGG - Intronic
1147537512 17:41330257-41330279 CCTAATCAGGAGGCTGAAGCAGG + Intergenic
1147703677 17:42411707-42411729 CCTCAGGAGGAGGCAGCAGGGGG + Intronic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1147766576 17:42840494-42840516 CCTAATCGGGAGGCTGAGGCAGG + Intronic
1147833502 17:43313998-43314020 GCTAATCGGGAGGCTGAAGCAGG - Intergenic
1147926376 17:43948582-43948604 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
1148117763 17:45187336-45187358 GCTGAGCTGGATGCTGCAGCTGG - Intergenic
1148207066 17:45785450-45785472 CCTCTCCGGCCGGCTGCAGCGGG - Intronic
1148480189 17:47955039-47955061 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1148609637 17:48956108-48956130 CCTACTCGGGAGGCTGCGGCGGG - Intergenic
1148707351 17:49647194-49647216 GCTGAGCGGGAGGCTGAGGCTGG + Intronic
1148894299 17:50831146-50831168 CCTCTGAGTGAGGCTGCACCGGG - Intergenic
1149230765 17:54531452-54531474 CCTTTGAGGAAGGCTGCAGCAGG - Intergenic
1149433497 17:56614096-56614118 GCTCCTCGGGAGGCTGAAGCAGG - Intergenic
1149717815 17:58810967-58810989 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1149731496 17:58951217-58951239 GCTCCTTGGGAGGCTGCAGCAGG + Intronic
1149926509 17:60707101-60707123 GCTACACGGGAGGCTGCAGCAGG - Intronic
1149973816 17:61245922-61245944 ACTCAGCGTGAGGCTGAAGCTGG + Intronic
1150069552 17:62139574-62139596 CTGCAGCGGGAGGCTGAAGGTGG + Intergenic
1150175113 17:63046441-63046463 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1150774994 17:68074153-68074175 ACTCAGGGGGAGGCTGAGGCAGG + Intergenic
1151328939 17:73395380-73395402 TCTCCGGGAGAGGCTGCAGCGGG + Exonic
1151831890 17:76557626-76557648 CCTCAGCGCGACCCTGGAGCTGG - Intergenic
1152067922 17:78121648-78121670 CGTGTGCGGGAGGCTGCGGCAGG - Exonic
1152373898 17:79907999-79908021 ACTCAGCAGGAGGCTGGAGGCGG - Intergenic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152742625 17:82024990-82025012 CTCCAGCGTGAGGCTGCAGGAGG - Exonic
1152755764 17:82086397-82086419 GCTCAACGGGAACCTGCAGCTGG - Exonic
1152921375 17:83068184-83068206 CGACAGCGGGGGGCGGCAGCGGG + Intergenic
1152921622 17:83068834-83068856 CGACAGCGGGGGGCGGCAGCGGG + Intergenic
1153306507 18:3636521-3636543 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1153480575 18:5543360-5543382 GCTCAGCGCGCGGCGGCAGCGGG - Intronic
1153598852 18:6758433-6758455 GCTACTCGGGAGGCTGCAGCTGG - Intronic
1153781310 18:8497339-8497361 CCTCAGCAGGAGGCTGAGACAGG - Intergenic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1154382540 18:13865723-13865745 GCTACGCGGGAGGCTGAAGCAGG - Intergenic
1155039345 18:22052068-22052090 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1159161238 18:64646059-64646081 GCTCTGGGTGAGGCTGCAGCTGG + Intergenic
1159227953 18:65564959-65564981 CCTGAGCGGGTTGCTGCTGCTGG + Intergenic
1159536824 18:69725597-69725619 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1159677129 18:71299256-71299278 GCTATGCGGGAGGCTGAAGCAGG - Intergenic
1160237956 18:77100797-77100819 GCACTGCGGGAGGCTGAAGCAGG - Intronic
1160384170 18:78485037-78485059 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384198 18:78485162-78485184 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384237 18:78485373-78485395 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384272 18:78485539-78485561 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384333 18:78485832-78485854 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384385 18:78486084-78486106 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384404 18:78486168-78486190 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384447 18:78486379-78486401 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160384466 18:78486463-78486485 CATCAGGAGGAGGCTGCAGGTGG - Intergenic
1160463964 18:79059986-79060008 CCTCTGCTGTAGGCTGGAGCTGG + Intergenic
1161078311 19:2297414-2297436 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1161372150 19:3918800-3918822 CCACAGCGCGAGGCCCCAGCCGG + Exonic
1161417328 19:4154755-4154777 TCTCAGCGAGGGGCAGCAGCTGG + Intronic
1161545694 19:4878658-4878680 CCCAAGTGGGAGGCCGCAGCTGG + Intergenic
1161717639 19:5885936-5885958 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1161724630 19:5921366-5921388 TCTCAGGGTGTGGCTGCAGCAGG - Intronic
1161792079 19:6366183-6366205 CCTCACAGGGAGGCTGGAGGTGG - Intronic
1162040814 19:7970082-7970104 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1162292152 19:9788275-9788297 CAGCACTGGGAGGCTGCAGCAGG - Intronic
1162443086 19:10705348-10705370 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162654526 19:12118147-12118169 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1162772529 19:12957736-12957758 GCTCCGCGGGAGGCTGAGGCAGG + Intergenic
1162982401 19:14248331-14248353 CCTCGGCGGGAGGGTGCACGGGG + Intergenic
1163213000 19:15855265-15855287 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1163222267 19:15930178-15930200 CCACATCTGGAGGCTGCAGGGGG - Intronic
1163340306 19:16701848-16701870 GCTCCTCGGGAGGCTGAAGCAGG + Intergenic
1163368822 19:16890566-16890588 CCTCTGCGGAAGGGGGCAGCCGG + Exonic
1163768886 19:19178846-19178868 CCTACTCGGGAGGCTGAAGCGGG + Intronic
1164223405 19:23218384-23218406 GCTATTCGGGAGGCTGCAGCAGG - Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164724639 19:30457885-30457907 CCTCTGCTGCAGGCTGCAGATGG - Intronic
1164759722 19:30719777-30719799 CCAGAGCCGGAGGCCGCAGCGGG - Intergenic
1164772886 19:30825562-30825584 GCTCCTCGGGAGGCTGAAGCAGG + Intergenic
1165740145 19:38200266-38200288 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165815395 19:38638887-38638909 CAACAGTGGGAGGCTGCAGCAGG + Intergenic
1165832070 19:38735317-38735339 CCCCAAGGGGAGGCCGCAGCGGG + Intronic
1165937423 19:39397808-39397830 CCGCAGCGGGAGCCAGCAGGGGG + Exonic
1166166254 19:40991259-40991281 GCCCAGTTGGAGGCTGCAGCAGG + Intergenic
1166538692 19:43592076-43592098 TCTCATCGAGAGCCTGCAGCAGG + Exonic
1166711368 19:44939609-44939631 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1167278754 19:48554227-48554249 CCCCAGGGGGATGCTCCAGCAGG - Intronic
1167504894 19:49866122-49866144 CCTAATCGGGAGGCTGAAGCGGG - Intronic
1167681926 19:50928814-50928836 CCTGAGCTGGGGGCTGGAGCAGG + Intergenic
1202700154 1_KI270712v1_random:158337-158359 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
925274592 2:2639810-2639832 CTTCTGCGGGAGGCTGATGCTGG - Intergenic
926320676 2:11746683-11746705 CCACAGCGGGAGGCTGGAGGCGG - Intronic
926975132 2:18507700-18507722 CTACAGCGGGAGGCTGAGGCAGG - Intergenic
929146911 2:38714324-38714346 GCTAATCGGGAGGCTGAAGCAGG - Intronic
929230983 2:39560009-39560031 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
929660977 2:43784549-43784571 TCCCAGCGGGAGGCTGAGGCAGG - Intronic
931348357 2:61467394-61467416 CCTCGGCAGGAGGCTGAGGCAGG - Intronic
931391017 2:61844029-61844051 GCTACTCGGGAGGCTGCAGCAGG + Intronic
931545704 2:63383599-63383621 GCTACTCGGGAGGCTGCAGCAGG + Intronic
932246661 2:70202350-70202372 CCACAGGGTGAGCCTGCAGCAGG - Intronic
932615177 2:73227034-73227056 CCTCAGCAGGAGAATGCAGCAGG - Exonic
933782079 2:85809806-85809828 GCTCATCGGGAGGCTGAAGTGGG + Intergenic
934171087 2:89541812-89541834 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
934281393 2:91616130-91616152 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
935729302 2:106051892-106051914 TCTGAGGGTGAGGCTGCAGCTGG - Intergenic
936283797 2:111165312-111165334 CGTGAGCTGGATGCTGCAGCTGG - Exonic
936399121 2:112152466-112152488 CCCCAAAGGGAGGCTCCAGCTGG + Intronic
937335828 2:121061857-121061879 TGCCAGCGGGAGGCTGCAGGAGG + Intergenic
937355783 2:121197203-121197225 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
937590440 2:123607048-123607070 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
937923904 2:127153170-127153192 GCTAAGTGGGAGGCTGAAGCAGG + Intergenic
937966374 2:127514678-127514700 GCTCCGTGTGAGGCTGCAGCTGG - Intronic
938531008 2:132186027-132186049 CCTGCTCGGGAGGCTGAAGCAGG + Intronic
939176936 2:138759839-138759861 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
939372122 2:141314677-141314699 CCTAATCGGGAGGCTGAGGCAGG + Intronic
939685128 2:145189463-145189485 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
941476205 2:165953970-165953992 CCTCCGCCGGAGAGTGCAGCTGG + Intergenic
942022851 2:171884124-171884146 CCTCTTTGGGAGGCTGAAGCAGG - Intronic
942053369 2:172161713-172161735 GCTCACTGTGAGGCTGCAGCTGG + Intergenic
942468150 2:176230592-176230614 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
943336596 2:186622872-186622894 GCTACTCGGGAGGCTGCAGCAGG - Intronic
944560771 2:200935232-200935254 GCTACGCGGGAGGCTGAAGCAGG - Intronic
944640954 2:201724999-201725021 CCTACTCGGGAGGCTGAAGCAGG + Intronic
944654200 2:201861670-201861692 CCTACTCGGGAGGCTGAAGCAGG - Intronic
945549137 2:211197435-211197457 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
945902960 2:215559194-215559216 GCTACTCGGGAGGCTGCAGCGGG - Intergenic
945934157 2:215886241-215886263 CCTCGGCTGGTGGGTGCAGCGGG + Intergenic
946104259 2:217355411-217355433 GCTACTCGGGAGGCTGCAGCAGG + Intronic
946255037 2:218435948-218435970 GCTACGCAGGAGGCTGCAGCAGG - Intronic
946737488 2:222768513-222768535 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
946748269 2:222866944-222866966 GCTCCTCGGGAGGCTGCGGCAGG - Intronic
947232879 2:227905864-227905886 GCTAATCGGGAGGCTGAAGCAGG - Intronic
947446205 2:230164509-230164531 CCTCACTGGGAGGCTGAAGGGGG + Intergenic
947758378 2:232585850-232585872 TCTCAGCAGGAGGAAGCAGCTGG - Intergenic
947852506 2:233299679-233299701 TCTCGGCGGCTGGCTGCAGCAGG + Intergenic
948182724 2:235995400-235995422 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
948386823 2:237585756-237585778 GCTCAGCTGGAGTCTGCAGGGGG - Intronic
948567007 2:238893813-238893835 CCTCCGCGGCAGCCTGCACCCGG + Intronic
948801188 2:240434401-240434423 CATCACCTGGAAGCTGCAGCGGG - Intergenic
1168793591 20:596290-596312 GCACTTCGGGAGGCTGCAGCAGG + Intergenic
1168921121 20:1537165-1537187 CAGCAGCCGGAGGCAGCAGCAGG + Exonic
1169130823 20:3165688-3165710 CTGCAGCGGGAAGCTACAGCAGG - Intronic
1169277438 20:4243354-4243376 CCTCATCGGGATCCTTCAGCCGG - Intronic
1169367243 20:5001460-5001482 CCGGAGGCGGAGGCTGCAGCGGG - Intronic
1171103350 20:22407721-22407743 CCACAGGAGGAGACTGCAGCAGG + Intergenic
1171503868 20:25617626-25617648 CCTACGCGGGAGGCTGAAGCAGG - Intronic
1172139681 20:32713610-32713632 CCTCACAGGGTGGCTTCAGCTGG - Intronic
1172146101 20:32759593-32759615 CCTAATCGGGAGGCTGAGGCAGG + Intergenic
1173234533 20:41232699-41232721 CCCCCGCGGGAGGCTGAGGCAGG - Intronic
1173580856 20:44145490-44145512 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1173666949 20:44769790-44769812 CCTCAGCTGGGGGCTTCTGCTGG - Intronic
1173794551 20:45850096-45850118 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1175369992 20:58481736-58481758 CCTCAGCTGGAGGCCGAAGCTGG - Intronic
1175442418 20:59001250-59001272 CTGCAGCGAGAGGCTGGAGCTGG + Intronic
1175631199 20:60537695-60537717 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
1175716040 20:61254254-61254276 GCTCTGCGGGAGGCTGCCGGTGG - Intronic
1175901563 20:62361849-62361871 CACAAGCAGGAGGCTGCAGCTGG - Intronic
1176075407 20:63246037-63246059 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
1176183095 20:63761668-63761690 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1177357682 21:20030684-20030706 GCTCACTGCGAGGCTGCAGCTGG + Intergenic
1177546310 21:22562851-22562873 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1177732898 21:25051943-25051965 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
1178852860 21:36227736-36227758 CCTCAGCAAGAGGCTGCACCAGG - Exonic
1179287237 21:39988089-39988111 CTTCAGCTCGAGGCTGCAACAGG - Intergenic
1179989968 21:44942773-44942795 CCACATGGGGAGGCTGCAGGAGG + Intronic
1180151572 21:45950831-45950853 CCGCTGCGGGAGGCTGCCACGGG - Intergenic
1180782386 22:18528549-18528571 CCTCCGCAGCAGGCTGCAGAGGG - Exonic
1180945152 22:19688603-19688625 GCTGAGGGGGAGGCTGCACCAGG - Intergenic
1181017830 22:20081205-20081227 GTTGGGCGGGAGGCTGCAGCGGG + Intronic
1181239275 22:21467884-21467906 CCTCCGCAGCAGGCTGCAGAGGG - Intergenic
1181579496 22:23819936-23819958 CCTCCTCGAGAGGCTGAAGCAGG - Intronic
1181635749 22:24173720-24173742 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1181732387 22:24856582-24856604 CCTCAGCGGGAGGAAGCAAAGGG + Intronic
1182238536 22:28896060-28896082 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1183350331 22:37331230-37331252 CCTGGGCGGGAGGCTGCAGCTGG - Intergenic
1183642222 22:39099687-39099709 CCTCAGCTGTGGGCAGCAGCCGG + Intronic
1183729227 22:39608001-39608023 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1183797347 22:40130669-40130691 CCCCCGCGGGAGGCTGAGGCAGG + Intronic
1183964047 22:41430750-41430772 CCTACTCGGGAGGCTGGAGCAGG - Intergenic
1184526795 22:45028789-45028811 CCACAGCGGGTGGCTCCAGGTGG - Intergenic
1184751013 22:46486729-46486751 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1184764044 22:46562290-46562312 CCTCACAGGGATGCTGGAGCAGG - Intergenic
950418961 3:12885548-12885570 CCCCAGCAGGGGTCTGCAGCTGG + Intergenic
950838276 3:15941464-15941486 CCTCAGTGGGTTGCTGCTGCTGG + Intergenic
951262285 3:20523956-20523978 CATCTCAGGGAGGCTGCAGCAGG + Intergenic
951884941 3:27515145-27515167 CCTCTTTGGGAGGCTGAAGCAGG + Intergenic
952171942 3:30816655-30816677 GCTACTCGGGAGGCTGCAGCAGG - Intronic
952793449 3:37218302-37218324 GCTCCCTGGGAGGCTGCAGCTGG - Intergenic
953082031 3:39629661-39629683 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
953234650 3:41095603-41095625 CCTCAGAGCAAGTCTGCAGCGGG - Intergenic
953755669 3:45643791-45643813 GCTCAGTGGAAGGCTGCAGAGGG + Intronic
954001349 3:47559806-47559828 GCTAAGCGGGAGGCTGAGGCAGG - Intergenic
954162337 3:48731706-48731728 GCTACTCGGGAGGCTGCAGCAGG + Intronic
954560513 3:51552372-51552394 CCTACTCGGGAGGCTGAAGCAGG - Intronic
954612459 3:51953019-51953041 CCTATGCGGGAGGCTGAGGCAGG + Intergenic
954623334 3:52008125-52008147 GCTATGCGGGAGGCTGAAGCAGG - Intergenic
954685868 3:52369870-52369892 CCACAGCGGGAGACTGTAGCTGG - Exonic
955111785 3:55957756-55957778 GCTCCGTGTGAGGCTGCAGCTGG + Intronic
956027033 3:64993959-64993981 ACTCAGAGGCAGTCTGCAGCTGG + Intergenic
956827530 3:73012409-73012431 GCTAAGCGGGAGGCTGAGGCAGG - Intronic
957845071 3:85721607-85721629 GCTCTCCGTGAGGCTGCAGCTGG + Intronic
957915425 3:86682492-86682514 CCTCAGGCAGAGGCTGCAGCAGG + Intergenic
958028487 3:88077442-88077464 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
958531346 3:95335439-95335461 TCCCAGAGGGAGGCTGAAGCGGG - Intergenic
958976104 3:100669416-100669438 CCTCAGCAGGAGACTACAGGAGG - Intronic
959049611 3:101512635-101512657 CCTCAGCAGGTAGCTGCTGCTGG - Intronic
959721489 3:109495039-109495061 CCTACTCGGGAGGCTGAAGCAGG + Intergenic
960899715 3:122542589-122542611 GCTACTCGGGAGGCTGCAGCAGG - Intronic
961246525 3:125458700-125458722 GCTACGCGGGAGGCTGAAGCAGG + Intronic
961351383 3:126306856-126306878 CCAGAGATGGAGGCTGCAGCTGG - Intergenic
961822916 3:129584416-129584438 CCTCGGCAGGAGGTTGCAGTAGG + Exonic
961875859 3:130023336-130023358 GCTAATCGGGAGGCTGAAGCAGG + Intergenic
962854462 3:139331283-139331305 CCTACTCGGGAGGCTGAAGCAGG - Intronic
963432571 3:145228622-145228644 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
963980903 3:151535943-151535965 TCTCAGCAAGAAGCTGCAGCTGG - Intergenic
964881019 3:161423060-161423082 ACTCTGCGGGAGGCTGAGGCAGG - Intergenic
965225153 3:165979524-165979546 CCTAATTGGGAGGCTGAAGCAGG - Intergenic
965246180 3:166272677-166272699 GCTCCTCGGGAGGCTGAAGCAGG + Intergenic
967887273 3:194341784-194341806 CCTCAGCGACAGTCTCCAGCTGG + Exonic
967891197 3:194365725-194365747 CCTCAGCATGAAGCTGGAGCCGG - Intronic
967904326 3:194487748-194487770 CCGCAGCCAGAGGCTGCAGGTGG - Intronic
968111257 3:196048571-196048593 CCTGAGGCGGAGGCTGCAGTGGG + Intronic
968338695 3:197936050-197936072 CCTGCTCGGGAGGCTGAAGCAGG + Intronic
968430783 4:557103-557125 TCTCATCGGGAGGCTGAAGCAGG + Intergenic
969492728 4:7509346-7509368 CCACAATGGGAGGCTCCAGCAGG - Intronic
969519231 4:7666134-7666156 ACTCAGGGGGAGGCAGGAGCCGG + Intronic
969581616 4:8068695-8068717 GCTGAGCGGGAGCCCGCAGCGGG - Intronic
969615753 4:8251740-8251762 CGTCGCTGGGAGGCTGCAGCAGG + Intergenic
969719006 4:8882802-8882824 GCTCAGCGGGAGGGTGCCACAGG - Intergenic
970123469 4:12783673-12783695 GCTATGCGGGAGGCTGAAGCAGG - Intergenic
971403830 4:26301902-26301924 GCTACTCGGGAGGCTGCAGCAGG - Intronic
971618915 4:28828982-28829004 CCTGAGCGGGATGCTACTGCTGG - Intergenic
972390494 4:38608517-38608539 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
972439920 4:39078272-39078294 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
972470532 4:39399585-39399607 GCTGCTCGGGAGGCTGCAGCAGG + Intergenic
972548822 4:40108422-40108444 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
972588925 4:40465565-40465587 CCTACTCGGGAGGCTGAAGCAGG + Intronic
972909358 4:43796191-43796213 CCTCCTCGGGAGGCTGAAGCAGG - Intergenic
972975286 4:44626885-44626907 GCTACGCGGGAGGCTGAAGCAGG - Intronic
973534421 4:51867131-51867153 GCTCTGTGCGAGGCTGCAGCTGG + Intronic
974017465 4:56661426-56661448 CCTCATAGAGAGGCTGCAGAAGG - Intronic
974748386 4:66105144-66105166 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
975202376 4:71607044-71607066 CCCCAGCGGGTTGCTGCTGCTGG + Intergenic
975335169 4:73168039-73168061 CTACAGCAGGAGGCTGAAGCAGG + Intronic
976213308 4:82692892-82692914 CCTGAGGGAGAGGCTGAAGCTGG + Intronic
977492373 4:97731645-97731667 CCTCAGGCAGAGGCTGCAGTTGG + Intronic
977853347 4:101857419-101857441 CCACAGCAAGAGGCAGCAGCAGG - Intronic
978492304 4:109322366-109322388 CCTGAGCGGGTTGCTGCTGCTGG - Intergenic
978944039 4:114472698-114472720 GCTCTGTGTGAGGCTGCAGCTGG - Intergenic
981308346 4:143269844-143269866 GCTCATCGGGAGGCTGAGGCAGG - Intergenic
983026500 4:162743869-162743891 ACTCAGTGGGAGGCTGAGGCAGG + Intergenic
984738914 4:183139922-183139944 CCTACTCGGGAGGCTGAAGCAGG - Intronic
984879591 4:184398887-184398909 CGTCAGCGGGAGGCTCCGGGAGG - Intronic
985055232 4:186030280-186030302 TCACAGCAGGAGGCTGCTGCAGG + Intergenic
985275400 4:188233260-188233282 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
985320988 4:188710953-188710975 CCTACTCGGGAGGCTGAAGCAGG + Intergenic
985526236 5:403522-403544 GCTACTCGGGAGGCTGCAGCAGG + Intronic
985759437 5:1737568-1737590 CCGAAGGGGGAGACTGCAGCGGG - Intergenic
985769281 5:1799076-1799098 GCTCAGGTCGAGGCTGCAGCTGG - Intronic
985793344 5:1944544-1944566 GCACAGCAGGAGGCTGCAGGAGG + Intergenic
985965361 5:3335462-3335484 CCACAACGGGGGGCTGCAGGAGG + Intergenic
986928950 5:12794869-12794891 CCTCAGCGCGGCGCTGCCGCAGG - Intergenic
987861565 5:23493562-23493584 GCTATTCGGGAGGCTGCAGCGGG - Intergenic
987929558 5:24387385-24387407 CCTGAGCGGGTTGCTGCTGCTGG - Intergenic
988605134 5:32672872-32672894 CCCCAGCGGGTTGCTGCTGCTGG + Intergenic
988839737 5:35072005-35072027 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
988856364 5:35231488-35231510 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
988967360 5:36432521-36432543 GCACAGGGGGAGGCTGCATCGGG + Intergenic
989221764 5:38974159-38974181 GCTACTCGGGAGGCTGCAGCAGG - Intronic
989496740 5:42117484-42117506 CCCCAGCGGGTTGCTGCTGCTGG - Intergenic
990609691 5:57444792-57444814 TCTCAGCTGGAGGCTGCTGGTGG - Intergenic
990783689 5:59395444-59395466 CCTAACTGGGAGGCTCCAGCAGG + Intronic
991039564 5:62161898-62161920 GCTCTGTGCGAGGCTGCAGCTGG + Intergenic
991102812 5:62811965-62811987 TCTCCTCGGGAGGCTGAAGCAGG + Intergenic
991633667 5:68681709-68681731 CCTCAGGGGGAGTGGGCAGCTGG - Intergenic
992129979 5:73682527-73682549 TCTCAGCTGGAGGCTGAGGCAGG - Intronic
992444533 5:76821689-76821711 GCTACTCGGGAGGCTGCAGCAGG - Intronic
992915332 5:81445009-81445031 GCTACTCGGGAGGCTGCAGCAGG + Intronic
992950365 5:81852004-81852026 CCGCGGCGGGAGGCGGCCGCAGG - Intergenic
993647225 5:90475821-90475843 GCTCCTCGGGAGGCTGAAGCAGG - Intronic
994239575 5:97405866-97405888 GCTCTGTGGGAGGCTGCAGCTGG + Intergenic
997515391 5:134484575-134484597 CCTACGTGGGAGGCTGAAGCAGG + Intergenic
998376395 5:141693678-141693700 CTGCAGCGAGCGGCTGCAGCAGG - Intergenic
998810350 5:145960124-145960146 CAGGAGCTGGAGGCTGCAGCGGG - Intronic
998846662 5:146316842-146316864 GCTCATCGGGAGGCTGAGGCAGG + Intronic
999414142 5:151380236-151380258 CCTAGGTGGGAGGCTGCGGCGGG + Intergenic
999535295 5:152510021-152510043 CATCATGGGGAGGCTGAAGCAGG - Intergenic
1000336852 5:160247784-160247806 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1001070989 5:168584878-168584900 GCTACGCAGGAGGCTGCAGCAGG - Intergenic
1002189772 5:177472523-177472545 GCTCAGCGGGAGACAACAGCTGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002439630 5:179257560-179257582 CATCAGCGGGAGCCAGCAGCGGG - Intronic
1002499479 5:179638459-179638481 GCTCAGCTGGAGACTGTAGCTGG - Intergenic
1002511927 5:179725874-179725896 CCTATTCGGGAGGCTGAAGCAGG + Intronic
1002611444 5:180421134-180421156 ACTCAGCGGGAGGCTGAGGCAGG + Intergenic
1002723717 5:181281605-181281627 CCTGAGCGGTAGGCGGGAGCTGG + Intergenic
1003024856 6:2545190-2545212 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1003084108 6:3047681-3047703 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1003727113 6:8777226-8777248 GCTAAGCGGGAGGCTGAGGCAGG + Intergenic
1003892833 6:10578556-10578578 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1004182589 6:13393888-13393910 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1004793186 6:19051372-19051394 TCTCAGGCAGAGGCTGCAGCAGG - Intergenic
1005041220 6:21602148-21602170 CCTCAGGGAGAAGCTGCAGCGGG + Intergenic
1005584839 6:27266299-27266321 TCCCAGCCGGAGGCTGAAGCAGG + Intergenic
1005711071 6:28503218-28503240 CCTGAACGGGAGGGTGCAGAGGG + Intergenic
1006055000 6:31377691-31377713 CCTCAGCGGGAGGCTGCAGCAGG - Intergenic
1006825597 6:36932784-36932806 GCTACCCGGGAGGCTGCAGCAGG + Intergenic
1007029681 6:38616755-38616777 CCTGAGCGGGTTGCTGCTGCTGG - Intronic
1007258252 6:40543682-40543704 CCTGAGCGGGAAGCAGCTGCAGG + Intronic
1007935328 6:45727529-45727551 CCAAAGTGGGAGGCTGGAGCAGG + Intergenic
1009538146 6:64917135-64917157 GCTACGCGGGAGGCTGAAGCAGG + Intronic
1010075448 6:71792024-71792046 CCCCAGCGGGTTGCTGCTGCTGG - Intergenic
1010194359 6:73224662-73224684 GCTCCTCGGGAGGCTGCGGCAGG + Intronic
1012302313 6:97604782-97604804 GCTATTCGGGAGGCTGCAGCAGG - Intergenic
1012405384 6:98890805-98890827 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1013272212 6:108555838-108555860 GGTCAGAGGGAGGCTCCAGCTGG + Intergenic
1014220027 6:118790571-118790593 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1014505193 6:122247128-122247150 GCTCTGTGGGAGCCTGCAGCTGG + Intergenic
1015143421 6:129959588-129959610 GCTCCCGGGGAGGCTGCAGCTGG - Intergenic
1016813194 6:148280694-148280716 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1017719561 6:157235423-157235445 GCTACGCGGGAGGCTGAAGCAGG - Intergenic
1017863910 6:158425399-158425421 GCTACTCGGGAGGCTGCAGCCGG + Intronic
1019415504 7:924932-924954 GCTCAGGGGGAGACAGCAGCTGG + Intronic
1019507120 7:1397193-1397215 GCTACTCGGGAGGCTGCAGCAGG - Intergenic
1020115141 7:5471974-5471996 CCTCCTCGGGAGGCTGGGGCAGG + Intronic
1020213523 7:6172052-6172074 CTGGTGCGGGAGGCTGCAGCTGG - Intronic
1020275073 7:6619149-6619171 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1021087733 7:16443164-16443186 CCTCAGCAGGAGGCTTAAGCAGG + Intergenic
1021232851 7:18106698-18106720 GCACACTGGGAGGCTGCAGCAGG - Intronic
1021384889 7:20017492-20017514 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
1022391993 7:29951206-29951228 GCTCTGTGCGAGGCTGCAGCTGG - Intronic
1022798136 7:33749102-33749124 CCTCAGCAGGATGCTGCAAAGGG + Intergenic
1022803393 7:33797499-33797521 CCTCAGCGGGTTGCTGCTGCTGG + Intergenic
1023392612 7:39724385-39724407 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1023918572 7:44608607-44608629 CCTCAGCAGGAGGCTGAGGCAGG + Intronic
1025075408 7:55938090-55938112 GCTCCTCGGGAGGCTGAAGCAGG + Intronic
1025078731 7:55964674-55964696 CCTGGGCAGGAGGCTGCAGGGGG - Exonic
1026045767 7:66904409-66904431 CATCAGCGGGAGGCAGGAGCTGG - Intergenic
1026086596 7:67268063-67268085 GAGCAGCGGGAGCCTGCAGCAGG + Intergenic
1026476334 7:70739136-70739158 CCTAACCAGGAGGCTGAAGCAGG - Intronic
1026557383 7:71420236-71420258 CCCCAGCTCGAGGCTGCAGCAGG - Intronic
1026715035 7:72781454-72781476 CCTGAGCTGGAGGCTGGGGCAGG - Intronic
1027461419 7:78458744-78458766 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1027681854 7:81232382-81232404 GCTCTGTGTGAGGCTGCAGCTGG + Intergenic
1028596145 7:92547611-92547633 CCTCCCTGTGAGGCTGCAGCTGG - Intergenic
1029178934 7:98685458-98685480 CCTCGGCTGGCGGCTGCAGGAGG + Intergenic
1029700491 7:102243551-102243573 CCACATTGGGAGGCTGAAGCAGG + Intronic
1030421315 7:109309968-109309990 TGTCAGAGGGAGGCTGCAGGTGG - Intergenic
1031132248 7:117845960-117845982 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1032413596 7:131719148-131719170 CCACAGAAGGAGGCTGCAGGTGG - Intergenic
1033087719 7:138357673-138357695 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034290334 7:149925949-149925971 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1034660738 7:152766896-152766918 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1035200586 7:157262528-157262550 CCTACTCGGGAGGCTGCGGCAGG - Intronic
1035356438 7:158278443-158278465 GCTACGTGGGAGGCTGCAGCAGG + Intronic
1035681039 8:1488287-1488309 CCACAGCAGGAGGACGCAGCGGG + Intergenic
1035755622 8:2029025-2029047 CCTGAGGGCGAGGATGCAGCTGG - Intergenic
1036226034 8:6958248-6958270 CCTGGTGGGGAGGCTGCAGCTGG + Intergenic
1037577837 8:20224617-20224639 CCCAAGCGGGAAGCTGGAGCTGG + Intronic
1037756904 8:21716209-21716231 CCTCCTCGGGAGGCTGAAGCAGG + Intronic
1037816485 8:22115313-22115335 GCTCAGCGGGAGTGAGCAGCAGG + Exonic
1037818338 8:22123698-22123720 ACACAGCCGGTGGCTGCAGCGGG + Exonic
1038062515 8:23928738-23928760 CCTCAGCAGGTGGTAGCAGCAGG - Intergenic
1038587038 8:28799182-28799204 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1039552802 8:38455394-38455416 CCTCAGCTGGAGACTGGAGCTGG + Intronic
1039643331 8:39249012-39249034 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1040014615 8:42690337-42690359 CCTCAGCGGGTTACCGCAGCTGG - Intergenic
1040110976 8:43567109-43567131 CTTCAGGGGGAGGTTGCGGCAGG - Intergenic
1042609115 8:70577895-70577917 GCTCTGTGTGAGGCTGCAGCTGG - Intronic
1042611812 8:70608301-70608323 CCCCAGCGAGCGGCTGCAGCGGG - Exonic
1042847465 8:73183249-73183271 ACTCATCGGGAGGCTGAGGCAGG + Intergenic
1042847550 8:73184029-73184051 ACTCATCGGGAGGCTGAGGCAGG - Intergenic
1044275853 8:90298452-90298474 CCTCTCCTGGAGGCTGCAGGGGG - Intergenic
1044782139 8:95754103-95754125 CCTAATCGGGAGGCTGAGGCAGG - Intergenic
1045589007 8:103572283-103572305 CCTGAGCGGGTTGCTGCTGCTGG + Intronic
1047413481 8:124643584-124643606 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1048037742 8:130693393-130693415 CCTCAGGCAGAAGCTGCAGCTGG + Intergenic
1048865990 8:138762280-138762302 GCTCAGCTGGAGGCTGCAGGAGG - Intronic
1049124183 8:140771889-140771911 GCTACGCGGGAGGCTGAAGCAGG - Intronic
1049262153 8:141645610-141645632 CCCCAGCCGGAGGCAACAGCAGG - Intergenic
1049358035 8:142198399-142198421 CCTCAGAGTGGGGCAGCAGCCGG - Intergenic
1049380414 8:142311407-142311429 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1049673081 8:143878285-143878307 CCTCGGCGTGCGGCTCCAGCGGG + Intronic
1049750462 8:144280734-144280756 TCACAGCGGGAGGCTGAGGCAGG + Intronic
1050353868 9:4764738-4764760 GCTAATCGGGAGGCTGAAGCAGG + Intergenic
1050530420 9:6583562-6583584 GCTAAGCGGGAGGCTGAAGCAGG + Intronic
1050682691 9:8132251-8132273 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1051176532 9:14366595-14366617 ACTACTCGGGAGGCTGCAGCAGG - Intronic
1051661545 9:19431594-19431616 CCTCACCCTGAGGCTGGAGCAGG + Intronic
1052250676 9:26393935-26393957 CCTCAGGAGGAGGCTATAGCTGG + Intergenic
1052290961 9:26840164-26840186 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1052363928 9:27589927-27589949 CCTCAGGCAGAGGCTGCGGCTGG - Intergenic
1052589827 9:30477477-30477499 GCTACCCGGGAGGCTGCAGCAGG - Intergenic
1052863078 9:33448633-33448655 GCTAATCGGGAGGCTGAAGCAGG - Intergenic
1053016012 9:34662595-34662617 CAGCAGCAGGAGGCTGCAGAAGG + Exonic
1053742732 9:41157350-41157372 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1054739696 9:68792588-68792610 CCTACTCGGGAGGCTGAAGCAGG - Intronic
1055070070 9:72157149-72157171 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1055691221 9:78833170-78833192 GCTACGCGGGAGGCTGGAGCAGG + Intergenic
1056753304 9:89367229-89367251 CCTCAGCGGGACAGGGCAGCAGG + Intronic
1056877032 9:90343330-90343352 CCTGGGAAGGAGGCTGCAGCTGG - Intergenic
1057691375 9:97289743-97289765 GCTCCTCGGGAGGCTGCGGCAGG - Intergenic
1059154435 9:111977283-111977305 CCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1059204605 9:112452633-112452655 CCTACTCGGGAGGCTGAAGCTGG + Intronic
1059426378 9:114223340-114223362 GCTCAGAGGGAGGCTGGAGGAGG + Intronic
1059585923 9:115606262-115606284 CCTACTCGGGAGGCTGAAGCAGG - Intergenic
1060542226 9:124438717-124438739 CCTACTCGGGAGGCTGAAGCAGG + Intergenic
1060729964 9:126030970-126030992 ACTCAGCAGGAAGCTGCAGCTGG - Intergenic
1060963989 9:127701800-127701822 GCTACTCGGGAGGCTGCAGCAGG + Intronic
1061025521 9:128046354-128046376 GCTAATCGGGAGGCTGAAGCAGG + Intergenic
1062017435 9:134297831-134297853 CCTCATGGGGAGGCTGAGGCTGG + Intergenic
1062403166 9:136381363-136381385 CCTCAGGGAGCAGCTGCAGCAGG - Exonic
1062478936 9:136742628-136742650 CCTGTGCTGGAGGCTGCAGTGGG + Intronic
1185469235 X:372814-372836 CCTACTCGGGAGGCTGAAGCAGG + Intronic
1185872409 X:3674836-3674858 AATCAGCGGGGGGCTGCACCAGG + Intronic
1186512658 X:10142190-10142212 GCTCAGCGTGAGTCTGAAGCAGG + Exonic
1187061573 X:15791766-15791788 GCTACTCGGGAGGCTGCAGCAGG - Intronic
1188685189 X:33060723-33060745 GCTAACCGGGAGGCTGAAGCAGG + Intronic
1190360465 X:49644323-49644345 GCTCACTGCGAGGCTGCAGCTGG + Intergenic
1190369611 X:49727986-49728008 GCTCACTGTGAGGCTGCAGCTGG - Intergenic
1190808887 X:53864573-53864595 CCTCAGGCAGAAGCTGCAGCTGG - Intergenic
1190808914 X:53864709-53864731 CCTCAGGCAGAAGCTGCAGCTGG - Intergenic
1192362858 X:70450147-70450169 CCTGAGCGGGAGCCAGCAGGAGG - Exonic
1192484577 X:71513993-71514015 CCTGAGCGGGTTGCTGCTGCTGG - Intronic
1194167699 X:90540201-90540223 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1195086444 X:101418319-101418341 CTTCAGCGGGAGGCAGCAGAGGG + Intronic
1196022764 X:111007511-111007533 CCTCACCTGGAGGAGGCAGCTGG - Intronic
1196312905 X:114189227-114189249 CCTGAGCGGGTTGCTGCTGCTGG - Intergenic
1197019667 X:121671485-121671507 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1197775635 X:130117100-130117122 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1198172934 X:134125558-134125580 CTTCAGCGGTATGCTGGAGCAGG + Intergenic
1198515700 X:137404996-137405018 GCTACTCGGGAGGCTGCAGCAGG + Intergenic
1199301374 X:146218196-146218218 CCTCAACAGGAGGCTGAGGCAGG - Intergenic
1200424773 Y:3008859-3008881 GCTCTGTGTGAGGCTGCAGCTGG + Intergenic
1200513952 Y:4117981-4118003 GCTACGCGGGAGGCTGAAGCAGG + Intergenic
1201145362 Y:11062164-11062186 CCCCCAAGGGAGGCTGCAGCAGG + Intergenic
1202378779 Y:24259394-24259416 CCTGAGCAGGAGGCTGCACTGGG - Intergenic
1202492003 Y:25410727-25410749 CCTGAGCAGGAGGCTGCACTGGG + Intergenic