ID: 1006056531

View in Genome Browser
Species Human (GRCh38)
Location 6:31389408-31389430
Sequence CAACCTGCTGAGATTAGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006056526_1006056531 -2 Left 1006056526 6:31389387-31389409 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006056531 6:31389408-31389430 CAACCTGCTGAGATTAGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006056531 Original CRISPR CAACCTGCTGAGATTAGTCG AGG Intergenic
No off target data available for this crispr