ID: 1006057397

View in Genome Browser
Species Human (GRCh38)
Location 6:31395696-31395718
Sequence CTCTCCCTCAGCGCTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006057397_1006057407 3 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057407 6:31395722-31395744 GGACTCAGGGGCGGGGTCACAGG No data
1006057397_1006057405 -5 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057405 6:31395714-31395736 GAGAGGCTGGACTCAGGGGCGGG No data
1006057397_1006057403 -9 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057403 6:31395710-31395732 GAGGGAGAGGCTGGACTCAGGGG No data
1006057397_1006057408 14 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057408 6:31395733-31395755 CGGGGTCACAGGCGTTTCTCAGG No data
1006057397_1006057402 -10 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057402 6:31395709-31395731 TGAGGGAGAGGCTGGACTCAGGG No data
1006057397_1006057409 26 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057409 6:31395745-31395767 CGTTTCTCAGGTCCTTCTCGTGG No data
1006057397_1006057406 -4 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057406 6:31395715-31395737 AGAGGCTGGACTCAGGGGCGGGG No data
1006057397_1006057404 -6 Left 1006057397 6:31395696-31395718 CCAGAGCCAGCGCTGAGGGAGAG No data
Right 1006057404 6:31395713-31395735 GGAGAGGCTGGACTCAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006057397 Original CRISPR CTCTCCCTCAGCGCTGGCTC TGG (reversed) Intergenic
No off target data available for this crispr