ID: 1006059796

View in Genome Browser
Species Human (GRCh38)
Location 6:31411576-31411598
Sequence AGGCTCAGGATTCTGTCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059796_1006059804 -4 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059796_1006059806 1 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059796_1006059808 13 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059808 6:31411612-31411634 GGCAGGAGAGGAAGCCTTCAGGG 0: 1
1: 2
2: 2
3: 56
4: 400
1006059796_1006059807 12 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059807 6:31411611-31411633 AGGCAGGAGAGGAAGCCTTCAGG No data
1006059796_1006059803 -8 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371
1006059796_1006059809 18 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059809 6:31411617-31411639 GAGAGGAAGCCTTCAGGGCCAGG No data
1006059796_1006059810 19 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059796 Original CRISPR AGGCTCAGGATTCTGTCGGA GGG (reversed) Intronic
902113333 1:14101000-14101022 AGCCTCACGATTATGGCGGAAGG - Intergenic
902230588 1:15024901-15024923 ATGCTCAGGGTTCTGTCAGGAGG + Intronic
911518240 1:98895346-98895368 TGGCTCAGGATTCTGGAGGCTGG - Intronic
915656523 1:157365414-157365436 AGGTTCAGGATGCATTCGGAAGG + Intergenic
915658274 1:157380032-157380054 GGGCTGAGGTGTCTGTCGGAAGG + Intergenic
917967023 1:180185381-180185403 AGGCTCAGGGTTCTGATGGCAGG - Intronic
918183649 1:182108589-182108611 AGACTCAGTGTTCTGTAGGATGG + Intergenic
920059615 1:203218334-203218356 AGCCTCAGGAATCTGGTGGAGGG - Intronic
921327124 1:213997395-213997417 GGGCCCAGGACTCTGTCGGAAGG + Exonic
923079343 1:230639063-230639085 AGGCTGAGGATACAGTCAGACGG - Intergenic
923120381 1:230984598-230984620 ATGCTCAAAATTCTCTCGGAAGG + Intronic
924433812 1:244020918-244020940 TGGCTCATGATTCTGACGGCTGG - Intergenic
1065870531 10:29952572-29952594 AGGCTCATGATTCTGCAGGCTGG + Intergenic
1067349066 10:45459291-45459313 AGGCTCAGGCTTCTGGGGAAGGG + Intronic
1073104565 10:101024960-101024982 AGGTTCAGGATTCTGTTCTATGG + Intronic
1075721916 10:124592492-124592514 AGGCTCAGGATTCTGGGGTCAGG - Intronic
1076806033 10:132859236-132859258 AGGCTCAGGCACCTGACGGAGGG + Exonic
1078027911 11:7715919-7715941 AGTCCCAGGATTCTATCAGAGGG - Intergenic
1079436515 11:20458599-20458621 AGGGTCAGGATTCTGGCAGGTGG + Intronic
1087334500 11:96826276-96826298 AGGCTCATGTTTCTGACTGAAGG - Intergenic
1089398672 11:118152282-118152304 AGGTTCAGGATGCTGGAGGAGGG - Intronic
1089468819 11:118704668-118704690 AGGTTCAGGAGTCTGTTGTAAGG - Intergenic
1089537223 11:119168426-119168448 AGGCTCAGGTCTCTGCCTGAAGG + Intronic
1090902333 11:131044075-131044097 AGGCTCAGGCTTCTGGTTGAGGG - Intergenic
1094177320 12:27554256-27554278 AGGCTGAGAAATCTGGCGGATGG - Intronic
1098356558 12:69617870-69617892 AGGCCCAGGATTCTGCCTGTGGG - Intergenic
1101553686 12:105786677-105786699 GGGCTCAGGAATCTATAGGAGGG + Intergenic
1102402052 12:112638270-112638292 TGGCTCATGATTCTGTTGGCTGG - Intronic
1106462946 13:29989161-29989183 AGGCTCAGGATGCAGGCGCAGGG + Intergenic
1107078075 13:36345651-36345673 AGGCCCAGAATTAAGTCGGAGGG + Intronic
1113282815 13:108808898-108808920 AGGGACAGGATTCTCTAGGAAGG - Intronic
1117273104 14:54165155-54165177 AGCCTATGGATTCTGTCAGATGG - Intergenic
1120176746 14:81302416-81302438 AGGCTCAGTATCCCTTCGGATGG + Intronic
1127958712 15:63874961-63874983 ATGCTCAGAATTCTATCCGAGGG + Intergenic
1131034399 15:89211717-89211739 AGGCTTAGAGTTCTGTCGCACGG - Intronic
1131107295 15:89743870-89743892 AGGCTCAGGATGGTGGCGTAAGG + Intergenic
1132209066 15:100007199-100007221 GGGCTCAGCATTCAGACGGAGGG + Intronic
1133257585 16:4526808-4526830 GGGCTCATGCTTCTGTTGGAGGG - Intronic
1136106796 16:28035943-28035965 AGGCTCAGCTTTCGGTCAGAAGG - Intronic
1139953051 16:70681159-70681181 AGGCTCTGGGTCCTCTCGGAGGG + Intronic
1140822764 16:78678703-78678725 AGGGTCAAGATTTTGACGGAGGG + Intronic
1142109468 16:88323570-88323592 AGCCTCAGGACCCTGTGGGAAGG + Intergenic
1142790106 17:2257372-2257394 AGGCACAGGATTCTTTTGGCCGG - Intronic
1143200302 17:5108900-5108922 AGGAGCAGGATTCTGTGGGGAGG - Intronic
1153953388 18:10075998-10076020 AGGATGAGGATTCTGCAGGAAGG - Intergenic
1160451391 18:78968730-78968752 AGGCTCAGGAGGGTGTGGGAGGG - Intergenic
1162255762 19:9488287-9488309 TGGCTCAGGATTCTGCTGGTTGG - Intronic
1164048619 19:21564568-21564590 AAGTTCAGGAATCTGTGGGAAGG - Intergenic
1167562292 19:50233056-50233078 AGGCTCAGGACGCTGTCCCAGGG + Intronic
1168550462 19:57289291-57289313 ATGCTCAAGATTCTGCCTGAGGG - Intronic
925448547 2:3949314-3949336 AGCCTCAGGATTCTTCCTGATGG + Intergenic
929801872 2:45111462-45111484 AGGCTCAAGACTCTTTGGGAAGG + Intergenic
930561016 2:52959909-52959931 AGGCTCAGGATGCGGTGGGTGGG + Intergenic
934924834 2:98374992-98375014 AGGCTGAGTATTCTGTGGGCTGG - Intronic
937429447 2:121826039-121826061 TGGTTCAGGATTCTGTCCCAGGG + Intergenic
940772232 2:157851729-157851751 AGGCTGAGGATTCACTCAGAGGG + Intronic
942451505 2:176110921-176110943 AGGCTGAGAATTCTGGCGGGGGG + Intronic
947445091 2:230157127-230157149 AGGCTTAGGATTCTTGCTGAAGG - Intergenic
1170384259 20:15798714-15798736 AGCCTCAGTAATCTGTCTGAGGG - Intronic
1172636343 20:36412413-36412435 AGGCTCAGGGTTCTGTGAGGTGG + Intronic
954001796 3:47563490-47563512 AGGTTCAGGAGTTTGTCAGAGGG - Intronic
954152830 3:48666445-48666467 AGCCTCAGTATTATATCGGAGGG + Intergenic
954392960 3:50276924-50276946 GGGCGCAGGATTCAGCCGGAGGG + Intronic
955769709 3:62374820-62374842 AGGCTGAGGGTTCTTACGGAGGG + Intergenic
956279019 3:67536695-67536717 GGGCTCAGGAGTCTGTGAGAGGG - Intronic
962200087 3:133393880-133393902 AGCCTCTGGATTGTGTTGGACGG - Intronic
966833996 3:184035465-184035487 TGGCTCAGGATTCTCTGGGATGG - Intronic
967835874 3:193961910-193961932 AAGCTCAGGACTCTGTCATAAGG - Intergenic
967912698 3:194555452-194555474 TGGCTCTGGCTTCTGTGGGAAGG + Intergenic
967999658 3:195196080-195196102 AGGCACAGGGTTCTGCTGGACGG - Intronic
968118519 3:196108208-196108230 AGGCTCAGGTTTCAGGCTGAGGG + Intergenic
970612520 4:17738987-17739009 TGGCTCATGATTCTGCTGGATGG - Intronic
973215476 4:47664409-47664431 AGACTCAGGATTTTGTCTAAGGG + Intronic
979146049 4:117250465-117250487 AGGCTCACAATTATGGCGGAAGG - Intergenic
979389936 4:120116737-120116759 ACATTCAGGATTCTGGCGGACGG + Intergenic
986782887 5:11083760-11083782 AGGCTGTGGATTCTGTGGTAGGG + Intronic
987355755 5:17061978-17062000 AGTCCCATGATTCTGTGGGAGGG - Intergenic
990738193 5:58886982-58887004 AAGCTGAGGTTTCTGTGGGAAGG + Intergenic
991090158 5:62686625-62686647 TGGCTTAGGATTCTGTGGGTTGG + Intergenic
1005870500 6:29971445-29971467 AGGTTCAGGCTTCTGTCAGAGGG + Intergenic
1005885154 6:30091999-30092021 AGGCTCAGGAGGCAGTCAGAGGG - Intergenic
1006059796 6:31411576-31411598 AGGCTCAGGATTCTGTCGGAGGG - Intronic
1006072287 6:31506647-31506669 AGGCTCAGGCTTCTGTCAGAGGG - Intronic
1012128562 6:95461909-95461931 TGGCTCATGATTCTGGAGGATGG + Intergenic
1013120537 6:107136912-107136934 TGGCTCAGGATTCTGGTGGCCGG + Intergenic
1016971933 6:149772099-149772121 TGCCTCAGGATTCTGTCAGTCGG + Intronic
1019152839 6:170020261-170020283 AGGGTCAGGAAACTGTGGGATGG - Intergenic
1021362518 7:19733557-19733579 AGGCTTAGGCTTCTGGCAGAAGG + Intronic
1025818781 7:64944531-64944553 AGGTTCAGGATTCTGAAAGAAGG + Intergenic
1030024035 7:105304652-105304674 AGGCTCGGGATACTGTCTAATGG - Intronic
1030349141 7:108463831-108463853 AGGCTCAGGACTAAGTCGGGTGG + Intergenic
1032387754 7:131536394-131536416 ATGCTGAGGCTTCTGTGGGAGGG + Intronic
1034902838 7:154918081-154918103 GTGCTCAGGATCCTGTGGGAGGG - Intergenic
1036422418 8:8610643-8610665 AGGCTCAGGAATCAGGCAGATGG + Intergenic
1039235165 8:35495051-35495073 AGGGTCAGGATTCTGGCCCAGGG + Intronic
1044071490 8:87766123-87766145 AGGCACAGCATACTGTGGGAGGG - Intergenic
1044999787 8:97869353-97869375 AGGCTCGGTATTCTGTCGGTGGG - Intronic
1049360320 8:142209684-142209706 AGGCTCAGGCTGCTGTGGGAGGG - Intergenic
1052461202 9:28765737-28765759 CGGCTCATGATTCTGTAGGCTGG - Intergenic
1052673181 9:31584450-31584472 AGGCTCAGGATTCAGTTGCTTGG - Intergenic
1055607524 9:77986216-77986238 AGCAACAGGATTCTGTTGGATGG - Intronic
1057481873 9:95450984-95451006 AGGCTCAGGATGTTCTGGGAAGG + Intronic
1061539727 9:131271654-131271676 TGGCTCAGGATTCTGCCAAAGGG - Intronic
1061849144 9:133404460-133404482 AGGCCCAGGATGCTCTCTGAAGG - Intronic
1062479196 9:136743670-136743692 AGGCTCAGGCTTCTCTGGGCTGG - Intergenic
1186562760 X:10630502-10630524 AGTCTCAGGAATGTGTCTGAGGG + Intronic
1187201027 X:17133916-17133938 AGCCTGAGGATGCTGTCAGATGG + Intronic
1188066961 X:25674104-25674126 AGGTTCATGATTCTGTAGGTTGG + Intergenic
1188170238 X:26915504-26915526 AGGATTGGGTTTCTGTCGGATGG - Intergenic
1188562072 X:31480289-31480311 AGACTCAGGATTCTTTTGAATGG - Intronic
1192252709 X:69426100-69426122 AGGCTCAGGCTACTGTCCGTGGG - Intergenic
1197214109 X:123852125-123852147 AGACTCAGGATTCTTGCTGAAGG + Intergenic
1198371076 X:135989835-135989857 AGGGTCAGGAATGTGTAGGAGGG + Intronic
1199634886 X:149805462-149805484 AAGGTCAGGATTCTGAGGGAGGG + Intergenic
1200017643 X:153178990-153179012 ATGCTCAGGATTCTCAAGGAGGG + Intergenic
1201389051 Y:13477424-13477446 TGGCTCAGGATTCTGAAGGCTGG - Intronic