ID: 1006059797

View in Genome Browser
Species Human (GRCh38)
Location 6:31411577-31411599
Sequence CAGGCTCAGGATTCTGTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059797_1006059809 17 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059809 6:31411617-31411639 GAGAGGAAGCCTTCAGGGCCAGG No data
1006059797_1006059803 -9 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371
1006059797_1006059807 11 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059807 6:31411611-31411633 AGGCAGGAGAGGAAGCCTTCAGG No data
1006059797_1006059804 -5 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059797_1006059806 0 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059797_1006059810 18 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059797_1006059808 12 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059808 6:31411612-31411634 GGCAGGAGAGGAAGCCTTCAGGG 0: 1
1: 2
2: 2
3: 56
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059797 Original CRISPR CAGGCTCAGGATTCTGTCGG AGG (reversed) Intronic
902105916 1:14035951-14035973 CAGGCTCAGGCTTCAGGCTGAGG + Intergenic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG + Intronic
915885112 1:159713715-159713737 CAGGAGCAGGATTCCTTCGGTGG - Exonic
916215480 1:162389858-162389880 CAGGCTCAGGATAAAGTGGGGGG - Intergenic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG + Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923356280 1:233159086-233159108 CTGGCTCCTGATTCTGTAGGTGG + Intronic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1063179886 10:3588594-3588616 CAGGCTCAGAATCCTCTCGGAGG - Intergenic
1065880861 10:30036717-30036739 CAGGCTCAGGATTTTGTTCATGG - Intronic
1067055086 10:43045446-43045468 CAGGCCCTGGATGCTGCCGGGGG - Intergenic
1068121580 10:52786373-52786395 CAGGCTCAGCCTTCTGGCTGTGG + Intergenic
1069813897 10:71181309-71181331 CAGTCTCAGCACTCTGTCTGAGG - Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG + Intronic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1084873472 11:72113368-72113390 CAGGCACAGCATTCTGTTGCTGG + Intergenic
1087367481 11:97239308-97239330 CAGTTTCAGGATTTTGTCTGAGG - Intergenic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1098356559 12:69617871-69617893 AAGGCCCAGGATTCTGCCTGTGG - Intergenic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1107078074 13:36345650-36345672 CAGGCCCAGAATTAAGTCGGAGG + Intronic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1117551961 14:56845571-56845593 CAGGCCCAGAATTCTATCGTTGG + Intergenic
1120651086 14:87133606-87133628 CATGCCCAGGACTCTGGCGGAGG + Intergenic
1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG + Intergenic
1125139847 15:36392787-36392809 CAGGCTTAGGAATATGTCTGTGG - Intergenic
1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG + Exonic
1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG + Intronic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG + Intergenic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG + Intronic
1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG + Intronic
1151789290 17:76293894-76293916 CAGGCTCTGGATTCTGCCAGTGG - Exonic
1158354366 18:56600297-56600319 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354376 18:56600365-56600387 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354386 18:56600433-56600455 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354396 18:56600501-56600523 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354426 18:56600705-56600727 CAGTCTCAATATTCTGTTGGAGG - Exonic
1160451392 18:78968731-78968753 CAGGCTCAGGAGGGTGTGGGAGG - Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1160766723 19:812112-812134 CAGGCTCAGTATTGTGACCGCGG + Exonic
1161091663 19:2363301-2363323 CAGGCTGGGGACTCTGTCCGCGG + Intergenic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
1167423671 19:49418322-49418344 CAGAGTCAGGATCCTATCGGGGG - Intergenic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
928445915 2:31333165-31333187 CAGGCTGAGGATTCTCTTGCTGG - Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
939864431 2:147456973-147456995 CAGGCTCAGCATGCTCTCAGGGG - Intergenic
940586411 2:155657815-155657837 CAGGCACTGGCTTCTTTCGGTGG - Intergenic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
1171232595 20:23499645-23499667 CAGGCTCAGGATTCACAGGGGGG + Intergenic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1175232203 20:57481175-57481197 CTGTTTCAGCATTCTGTCGGAGG - Intergenic
1175714855 20:61248401-61248423 GAGGGTCAGGATTCTGCTGGTGG + Intergenic
1176336629 21:5604873-5604895 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176391128 21:6216075-6216097 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1176470291 21:7100099-7100121 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176493852 21:7481877-7481899 CAGCTTCAGAATTCTGTAGGGGG + Intergenic
1176506790 21:7656506-7656528 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG + Intronic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
954149863 3:48651973-48651995 CAGGCTCCGCATTCACTCGGTGG + Exonic
954392959 3:50276923-50276945 CGGGCGCAGGATTCAGCCGGAGG + Intronic
954993642 3:54862427-54862449 AAGGCTCAGCATTCTGACGTTGG + Intronic
959085770 3:101849535-101849557 CTGGCTCAGGGAGCTGTCGGCGG - Exonic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
966920823 3:184610418-184610440 CAGCCTCAGGAATGTTTCGGGGG + Intronic
975631710 4:76410588-76410610 CAGTCTCAGGTTTCTGTGGAAGG - Intronic
975909291 4:79248607-79248629 CAGGCACAGGTTTGTGCCGGTGG - Intronic
979292946 4:118998038-118998060 CAGTGTTAGGATTCTGACGGGGG + Intronic
987355756 5:17061979-17062001 CAGTCCCATGATTCTGTGGGAGG - Intergenic
995530901 5:113091107-113091129 CAGCCTCAGGATTCCTTCTGTGG - Intronic
996373457 5:122776764-122776786 AAGGCTAAGCATTCTGTTGGGGG + Intronic
996730739 5:126715221-126715243 CAGTCTCAGGAGTCTATGGGAGG + Intergenic
999319106 5:150602224-150602246 CAGGCTCTGGGTTCTGGTGGTGG + Intronic
1000563696 5:162822220-162822242 CAGGCTCTGGCTTCCATCGGTGG - Intergenic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1015547960 6:134381209-134381231 CAGGCTCAGCACTCTTTTGGAGG - Intergenic
1020625493 7:10573682-10573704 CAGGCTCAGGATTGAGGCTGTGG - Intergenic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1036991840 8:13607092-13607114 CACACACAGGATCCTGTCGGTGG - Intergenic
1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG + Intronic
1042281956 8:67064674-67064696 CAGGCTCTGGAATCTGGGGGTGG + Intronic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1044999788 8:97869354-97869376 CAGGCTCGGTATTCTGTCGGTGG - Intronic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049780785 8:144427936-144427958 CAGGCGCAGGAAGCTCTCGGTGG + Intronic
1051394189 9:16601598-16601620 CAGGCTCAGGAGTGTGTAGTAGG - Intronic
1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG + Intergenic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG + Intronic
1059409273 9:114122029-114122051 CAGGCTCAGCTTTCTCTCTGGGG + Intergenic
1060544782 9:124453454-124453476 CAGGATCAGGACTCTCTGGGCGG + Exonic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1062000571 9:134213861-134213883 CAGGCCTAGGATTCTGTCCCGGG - Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1203425020 Un_GL000195v1:30029-30051 CAGCTTCAGAATTCTGTAGGGGG - Intergenic
1190327360 X:49215044-49215066 TAGGGTCAGGAGTCTGGCGGGGG + Intronic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190933014 X:54966377-54966399 CAGGCTCAGGATACTGAATGGGG - Intronic
1192252710 X:69426101-69426123 TAGGCTCAGGCTACTGTCCGTGG - Intergenic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG + Intergenic
1200017642 X:153178989-153179011 CATGCTCAGGATTCTCAAGGAGG + Intergenic