ID: 1006059798

View in Genome Browser
Species Human (GRCh38)
Location 6:31411580-31411602
Sequence CCACAGGCTCAGGATTCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059798_1006059808 9 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059808 6:31411612-31411634 GGCAGGAGAGGAAGCCTTCAGGG 0: 1
1: 2
2: 2
3: 56
4: 400
1006059798_1006059806 -3 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059798_1006059807 8 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059807 6:31411611-31411633 AGGCAGGAGAGGAAGCCTTCAGG No data
1006059798_1006059804 -8 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059798_1006059810 15 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059798_1006059809 14 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059809 6:31411617-31411639 GAGAGGAAGCCTTCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059798 Original CRISPR CCACAGGCTCAGGATTCTGT CGG (reversed) Intronic
900707069 1:4087490-4087512 GCACAGTCTCAGGGCTCTGTGGG - Intergenic
901478246 1:9505563-9505585 CCACAGGCTGGGGACTATGTAGG - Intergenic
902504343 1:16929780-16929802 AGGCAGGCTCAGGCTTCTGTAGG - Intronic
903209968 1:21812397-21812419 CCCCAAGCTGAAGATTCTGTGGG + Exonic
903769146 1:25753185-25753207 CCACAGTGTCAGGACTCTGGTGG - Intronic
906529244 1:46513790-46513812 ACATAGGCTCAGGCTTCTGTAGG + Exonic
907744477 1:57199072-57199094 CCCCAGCCTCAGGTTCCTGTTGG - Intronic
911209520 1:95124747-95124769 TTACAGGCTTAGTATTCTGTAGG - Intronic
913595982 1:120377632-120377654 TCACAGTCTCATTATTCTGTAGG + Intergenic
914091297 1:144501344-144501366 TCACAGTCTCATTATTCTGTAGG - Intergenic
914307306 1:146432855-146432877 TCACAGTCTCATTATTCTGTAGG + Intergenic
914594800 1:149140276-149140298 TCACAGTCTCATTATTCTGTAGG - Intergenic
915580450 1:156809792-156809814 CTGCAGGCTCAGGAGTCTGCTGG + Exonic
916313797 1:163425674-163425696 CCAGAGGCCCAGGAATCTTTAGG - Intergenic
919145708 1:193632136-193632158 CCACAGAGTCAGGTATCTGTGGG + Intergenic
919503023 1:198361916-198361938 CAAAAGGATCAGGTTTCTGTGGG - Intergenic
921826113 1:219673676-219673698 TCACTGGCTCATGATTCTGGAGG + Intergenic
922015502 1:221641928-221641950 CCACATGCTCAGCATTCTGCAGG - Intergenic
922898495 1:229118844-229118866 CCACAGGCTCAGCCACCTGTGGG - Intergenic
1063639286 10:7814545-7814567 CCACAGCCTCAGCATCCTTTAGG - Intergenic
1066240984 10:33534674-33534696 CCACAGGCTGATGAACCTGTTGG + Intergenic
1070384418 10:75911812-75911834 CCACATGCCCAGGATCCTGCTGG + Intronic
1070841849 10:79492829-79492851 CCACAGGCTCAGGGCTCTGCAGG + Intergenic
1074020260 10:109575310-109575332 CCACAGGATCAGTAGTCTGCTGG + Intergenic
1075063301 10:119271969-119271991 CCACAGTCTCATGACTCTGCTGG + Intronic
1076873172 10:133203375-133203397 CCACAGCCTCACGTTTCTCTTGG + Intronic
1076990849 11:272769-272791 CCACACACACAGGGTTCTGTCGG + Intergenic
1077113082 11:870456-870478 CCACAGGCCCCGGATGGTGTGGG - Exonic
1077304965 11:1864876-1864898 CCCCTGGCACAGGAGTCTGTGGG - Intronic
1079253009 11:18801267-18801289 CCTCTGGCTCAGGGTACTGTGGG - Intergenic
1079615675 11:22489872-22489894 CCACTGGGCCAGGCTTCTGTTGG - Intergenic
1084049565 11:66590973-66590995 CTGCAGGCTCAGAATTTTGTGGG + Exonic
1084461499 11:69298978-69299000 CCTCAAACTCAGGATTCTATAGG + Intronic
1085821526 11:79798765-79798787 TCAAAGGGTGAGGATTCTGTGGG - Intergenic
1087335754 11:96842222-96842244 CAACAGGCACAGACTTCTGTAGG - Intergenic
1091681566 12:2531290-2531312 CACCAGGCTCATGATTCTGGGGG - Intronic
1095515430 12:43000307-43000329 CACCATGCTCAGGATTATGTGGG + Intergenic
1096209287 12:49750822-49750844 CCACTGGCCCAGGATTCCTTAGG + Intronic
1096237963 12:49942635-49942657 CCAAATGCCCAGGATTCTGAGGG + Intergenic
1096934188 12:55253025-55253047 CCACAGGCCAAGGATTGTTTTGG - Intergenic
1099906106 12:88772086-88772108 CCACTGGCTCTAGATTCTTTAGG + Intergenic
1102039380 12:109791007-109791029 CCACAGGCACAAGAGCCTGTAGG + Intronic
1103089172 12:118085333-118085355 CAAGAGGCTTAGGATTCAGTTGG - Intronic
1103942752 12:124509877-124509899 CCGGAGGCTCAGGTTACTGTGGG - Intronic
1103952281 12:124557837-124557859 CCACAGGGTCAGGATTTGGGAGG - Intronic
1104774824 12:131384895-131384917 CCACAGCCTCTGGCTTCTGTTGG - Intergenic
1109986049 13:69986165-69986187 CCAGAGGCTGAGGAGACTGTGGG + Intronic
1110816684 13:79868558-79868580 CCACATTCTCAGGTTTCTATTGG - Intergenic
1112952208 13:105013302-105013324 ACAGAGGCTCAGGACTGTGTAGG + Intergenic
1113634618 13:111911007-111911029 CAAAAGTCTCAGGGTTCTGTAGG + Intergenic
1114500580 14:23165421-23165443 CCACAGCCTCAGGAACCTGAAGG + Exonic
1117010142 14:51462626-51462648 CTACAGGTACAGGATTCTGATGG - Intergenic
1118456414 14:65948842-65948864 CCACAGGCACAGCACACTGTGGG + Intergenic
1118652948 14:67917247-67917269 TCATTGGCTCATGATTCTGTAGG + Intronic
1118903136 14:70003054-70003076 CTCCAGCCTCAGGATTCTCTAGG - Intronic
1119640403 14:76310359-76310381 CCACGGGCTCAGGATCCGGAGGG + Intergenic
1120304693 14:82754224-82754246 CCTTATGCTCAGGATTATGTTGG - Intergenic
1126277520 15:46901564-46901586 CACCAGGCTCAGGAATCTGATGG + Intergenic
1132377416 15:101338749-101338771 CTACAGGCTCAGGAATCTGATGG - Intronic
1132378013 15:101344565-101344587 CCACAGGCAAGGGAGTCTGTGGG + Intronic
1132764753 16:1528769-1528791 CCACGGGCTCGGGGCTCTGTGGG - Intronic
1133740553 16:8647945-8647967 GCACAGGCTCAGGAGTCAGATGG - Exonic
1136748700 16:32614433-32614455 CCACAGGCTTGGGGTTGTGTTGG - Intergenic
1137605919 16:49786674-49786696 CCACAGGCTCTGGCTTCTGGAGG + Intronic
1138329605 16:56203114-56203136 ACACAGGCTCAGGATTAAGCTGG + Intronic
1139609011 16:68041232-68041254 CCAGAGGCTGAGGACTTTGTGGG - Intronic
1139746216 16:69076748-69076770 CCATAAGCACAGGATTCTGGTGG - Intronic
1141567352 16:84911698-84911720 CCATACGCTGAGGATGCTGTGGG - Intronic
1203050834 16_KI270728v1_random:873647-873669 CCACAGGCTTGGGGTTGTGTTGG - Intergenic
1143326731 17:6103922-6103944 ACACAGGCTCTGGAGTCTATAGG - Intronic
1144214858 17:13046505-13046527 ACACAGGCTCTGTATTCAGTGGG - Intergenic
1146465337 17:33081850-33081872 GCAGAGGCTTAGGCTTCTGTAGG + Intronic
1148154108 17:45412786-45412808 CCTGAGGCCCAGGATCCTGTGGG - Intronic
1149584031 17:57773056-57773078 CCACTGGCTGAGGATTTTCTTGG - Intergenic
1152170993 17:78748402-78748424 CAACAGGCCCAGGTTACTGTAGG + Intronic
1152493744 17:80655688-80655710 CCTCAGCCTCAGGAGTATGTAGG + Intronic
1153524675 18:5983583-5983605 CCACACTCTCAAGATCCTGTTGG + Intronic
1155108793 18:22693502-22693524 CCAGAAGCTCAGAATTCTGGGGG - Intergenic
1158354369 18:56600300-56600322 CCCCAGTCTCAATATTCTGTTGG - Exonic
1158354379 18:56600368-56600390 CCCCAGTCTCAATATTCTGTTGG - Exonic
1158354389 18:56600436-56600458 CCCCAGTCTCAATATTCTGTTGG - Exonic
1158354399 18:56600504-56600526 CCCCAGTCTCAATATTCTGTTGG - Exonic
1158354429 18:56600708-56600730 CCCCAGTCTCAATATTCTGTTGG - Exonic
1160534946 18:79586749-79586771 CCACAGGCTCGGGATTGAGGTGG + Intergenic
1160591276 18:79945885-79945907 CCTCAGCCTCAGGTCTCTGTGGG - Intronic
1161698671 19:5783765-5783787 CCAGAGGCTCTGGGTTTTGTGGG - Exonic
1165311714 19:35032521-35032543 CCGCAGGCTGAGGACACTGTGGG - Exonic
1165591281 19:36972424-36972446 TCACAGGCTCAGGATGCCGAAGG - Intronic
1167119545 19:47508302-47508324 CCAGAGGCTCAGCATCCTGAAGG + Intronic
1167476809 19:49706143-49706165 CCACAGTCTCAGGACACTGGCGG - Intronic
925154357 2:1638543-1638565 ACACAGGATTAGGATGCTGTAGG - Intronic
925296121 2:2778772-2778794 CCACAGGCTCTGTGCTCTGTGGG + Intergenic
925604665 2:5646979-5647001 TCACAGTCTCATTATTCTGTAGG + Intergenic
927909649 2:26887878-26887900 CCACAGGATCAGAATCCTCTTGG + Intronic
930232058 2:48853303-48853325 CCAAATGCCCAGGATTCTCTTGG - Intergenic
930561014 2:52959905-52959927 CCACAGGCTCAGGATGCGGTGGG + Intergenic
932231090 2:70085274-70085296 CCAGAGGCTCAGGTGTCTGTCGG - Intergenic
933025612 2:77253847-77253869 GCAAAGCCTCAGGAATCTGTGGG + Intronic
934618885 2:95792148-95792170 TCCCCGGCTCAGGTTTCTGTGGG + Intergenic
934642008 2:96032409-96032431 TCCCCGGCTCAGGTTTCTGTGGG - Intronic
934924835 2:98374996-98375018 CTGCAGGCTGAGTATTCTGTGGG - Intronic
939482464 2:142766754-142766776 AAAAAGGCTCAGGATTCTGCAGG + Intergenic
940997090 2:160161187-160161209 CTATAGGCTCAGAATTTTGTAGG + Intronic
941994040 2:171584839-171584861 CCAGAGACTCTCGATTCTGTGGG - Intergenic
942472860 2:176280584-176280606 CCACAAGGTCAGACTTCTGTTGG + Intronic
943902988 2:193465058-193465080 ACACAGCCTCAGGGATCTGTAGG + Intergenic
946534422 2:220610572-220610594 CCATAGGGTCAGGAGTCTGCAGG + Intergenic
946733262 2:222729680-222729702 CCACCGGGTCAGCATTCTCTGGG + Intergenic
1171162134 20:22936980-22937002 CCAGAGGCTCATGTTTCTTTAGG + Intergenic
1172415850 20:34766944-34766966 CCAAATGCTCAGACTTCTGTGGG + Intronic
1173365271 20:42379531-42379553 CCACAGGCTCAGGTGCCTCTAGG - Intronic
1175058258 20:56217981-56218003 CCACAGCCAGAGGATTCTCTGGG + Intergenic
1175714854 20:61248398-61248420 CTAGAGGGTCAGGATTCTGCTGG + Intergenic
1177882992 21:26716275-26716297 CTACAGGATCATGATTCTCTAGG - Intergenic
1178327441 21:31657298-31657320 ACACAGGCTCAGGGCTCTTTGGG + Intergenic
1179134921 21:38670834-38670856 CTACAGGCTCAGTACTCGGTGGG - Intergenic
1179312947 21:40212933-40212955 CCACAGGCTCAGCAGTGTGAAGG + Intronic
1179474511 21:41634630-41634652 TCACAGGCTGAGGGTTCTGCAGG - Intergenic
1181622806 22:24102603-24102625 CAACAGGCCCAGGTTTCTCTGGG - Intronic
1181912906 22:26254649-26254671 CCAAATGCTCAGCACTCTGTTGG - Intronic
1184249595 22:43252625-43252647 CCACAGGCTCAGGATCTACTGGG + Intronic
951507426 3:23463511-23463533 CCACAGGCTAAATGTTCTGTGGG - Intronic
953043943 3:39278888-39278910 ACTCAGGCTCAGGTTTGTGTGGG - Intronic
955792076 3:62598335-62598357 CCACAGTCATTGGATTCTGTGGG + Intronic
956496927 3:69837418-69837440 GTACAGGCTCAGTACTCTGTGGG - Intronic
958905156 3:99933923-99933945 ACAATGGCTCAGAATTCTGTGGG + Intronic
960087949 3:113610965-113610987 CCAGATGATCAGGATTCAGTAGG - Intronic
960163076 3:114371565-114371587 CCACAGGCTAAGTATTGTGCAGG - Intronic
962200088 3:133393884-133393906 CCAGAGCCTCTGGATTGTGTTGG - Intronic
962464381 3:135643083-135643105 AGACAAGCTCAGGATGCTGTGGG + Intergenic
963077327 3:141359276-141359298 CCAGAGATTCAGGTTTCTGTAGG - Intronic
963773770 3:149417924-149417946 CCACAGGAGCAGGAGTGTGTTGG - Intergenic
966692261 3:182753949-182753971 CCACAGCCTCAAGAATCTGGTGG + Intergenic
968532822 4:1104199-1104221 CCACAGACACAGAATCCTGTTGG - Intronic
968699104 4:2046494-2046516 CTACAGGCTCTGGGCTCTGTGGG - Intergenic
970057225 4:11988680-11988702 CCAAAGGCACAGGAATCTGCTGG + Intergenic
970114334 4:12676990-12677012 CTACAGACCCAGGATTGTGTAGG + Intergenic
970834995 4:20393343-20393365 CCCAAGGGTCAGGATTCTGGGGG - Intronic
976775069 4:88698516-88698538 CCACAGGCCAAAGATTCTGTAGG - Intronic
981616746 4:146650555-146650577 CCAGAGTCTTAGGATTTTGTGGG + Intergenic
984115366 4:175673902-175673924 TCACATGCTCATGATTCTTTTGG + Intronic
985777103 5:1850420-1850442 CAAAAGGCTCAGGCTTCTGCAGG - Intergenic
992871555 5:81010793-81010815 CCACAGGCGCAGGATTAGGAAGG - Intronic
994473883 5:100242792-100242814 TCAAAGTCTCATGATTCTGTGGG - Intergenic
994525858 5:100903859-100903881 ACCCTGGCTCAGGATTCTGCAGG + Intergenic
996423862 5:123291686-123291708 ACACAGGCACAGGATTCAGGGGG - Intergenic
998312160 5:141144398-141144420 ACAGAGGCTCAGGAACCTGTGGG + Intronic
1000846831 5:166292221-166292243 CCTCTGGCTCATGATTCTGCTGG + Intergenic
1002181286 5:177432375-177432397 CCACAGTGTCAGGCTTCTGAGGG + Intronic
1004759954 6:18655826-18655848 CCACATGCTCAGAAGTCTTTGGG - Intergenic
1005841071 6:29744904-29744926 CCCCAGGTTCAGGCTTCTATAGG + Intergenic
1005922636 6:30415737-30415759 CCCCAGGGTGAGGATTCTGTTGG - Intergenic
1006059798 6:31411580-31411602 CCACAGGCTCAGGATTCTGTCGG - Intronic
1006150299 6:31983467-31983489 CCAGAGGCTCAGGAGGCTGAGGG - Intronic
1006156600 6:32016205-32016227 CCAGAGGCTCAGGAGGCTGAGGG - Intronic
1006229708 6:32573652-32573674 TCACTGGCTCAGGGTTCTGCAGG - Intronic
1006561662 6:34918122-34918144 CCAAAGCCTTAAGATTCTGTGGG + Intronic
1013603837 6:111730261-111730283 CCACATGCAGAGGATCCTGTAGG + Intronic
1013825236 6:114203396-114203418 CCACAAGGTTAGGATTATGTGGG + Intronic
1015855442 6:137619316-137619338 CCACAGCCTCTGTGTTCTGTGGG + Intergenic
1017606591 6:156141230-156141252 ACACAGGCTCAGGTATATGTGGG - Intergenic
1018429667 6:163713296-163713318 CTCCAGCCTCAGGTTTCTGTGGG + Intergenic
1020614111 7:10437187-10437209 CCACAGGTTAAGGAGTCTGAAGG - Intergenic
1021380208 7:19956783-19956805 TAACTGGCTCAGGATTCTGCAGG - Intergenic
1024120770 7:46236272-46236294 ACAGAGCCTCAGGAATCTGTGGG + Intergenic
1025158481 7:56631269-56631291 GCACAGGCCCAGGATTCCCTGGG - Intergenic
1025637414 7:63335198-63335220 GCACAGGCCCAGGATTCCCTGGG + Intergenic
1025645283 7:63412901-63412923 GCACAGGCCCAGGATTCCCTGGG - Intergenic
1025728121 7:64086993-64087015 GCACAGGCCCAGGATTCCCTAGG + Intronic
1025757249 7:64356899-64356921 GCACAGGCCCAGGATTCCCTAGG + Intergenic
1027181658 7:75944889-75944911 ACAGAGCCTCAGGATTTTGTGGG + Intronic
1028499482 7:91502703-91502725 CTACATGGTCAGGATTTTGTGGG - Intergenic
1032154926 7:129459892-129459914 CCAAAGGCCCAGGATTGAGTAGG + Intronic
1032800461 7:135313457-135313479 AAACATGCTCATGATTCTGTAGG - Intergenic
1033254147 7:139785021-139785043 CCACTGACTCAGGAATCTCTGGG + Intronic
1033564543 7:142565891-142565913 CTACAGGCTCAGGCTTTTCTGGG + Intergenic
1037708147 8:21333100-21333122 CCACTGGCTCAGGATTGAGTAGG - Intergenic
1040372730 8:46793826-46793848 GCACAGGCCCAGGATTCCCTAGG + Intergenic
1041547157 8:59058554-59058576 CCACATTCTCAGGATCATGTGGG + Intronic
1041990649 8:63986711-63986733 CCACAGTTTCAGGCATCTGTGGG - Intergenic
1043454842 8:80402847-80402869 CAGTAGGCTCTGGATTCTGTGGG - Intergenic
1044999791 8:97869357-97869379 GCCCAGGCTCGGTATTCTGTCGG - Intronic
1048755131 8:137730225-137730247 ACAAAAGCTAAGGATTCTGTTGG - Intergenic
1053418131 9:37959473-37959495 CCACAGGCTCAGGAGACCGAGGG + Intronic
1056282130 9:85051823-85051845 CCACAGCTTCAAGTTTCTGTTGG - Intergenic
1058167000 9:101631593-101631615 ACCCAGGCTCAGAATTCTGCTGG + Intronic
1060206343 9:121684853-121684875 CCACTGGCCCAGGCTGCTGTGGG + Intronic
1061243097 9:129385735-129385757 CCAGAGGCTCATGATGCTGTTGG + Intergenic
1061698072 9:132393028-132393050 CCACAGGCCCAGGAGGCTGCTGG + Intronic
1061733575 9:132636208-132636230 CCACAGGCTCTGGAAGCTGAAGG + Intronic
1062407024 9:136401497-136401519 AAGCAGGCTCTGGATTCTGTTGG - Intergenic
1062479199 9:136743674-136743696 CCCCAGGCTCAGGCTTCTCTGGG - Intergenic
1186074791 X:5866365-5866387 CCAAATGCTCAGAATTCTCTAGG - Intronic
1189053131 X:37667758-37667780 CCTCTGGCTCATGATTCTGCAGG + Intronic
1189291725 X:39890775-39890797 CCACAGGCCCAGGAGTGGGTCGG + Intergenic
1190420826 X:50282554-50282576 CCCAAGGCTCAGGGTTCTGTAGG + Intronic
1191684286 X:63872835-63872857 ACAGAGACTCAGGATCCTGTGGG + Intergenic
1191724843 X:64268684-64268706 CCAAAGACTTAGGAATCTGTGGG - Exonic
1192553594 X:72072635-72072657 ACACAGGATCAGGATTCTGAAGG - Intergenic
1194150666 X:90322439-90322461 TAATAGGCTCAGGGTTCTGTGGG + Intergenic
1196462174 X:115942744-115942766 GCCCTGGCTCATGATTCTGTTGG - Intergenic
1198575218 X:138003154-138003176 CCAAAAGACCAGGATTCTGTAGG - Intergenic
1198682576 X:139198472-139198494 CCACAGGCAAAGGCTTCTGCTGG - Intronic
1200497032 Y:3899201-3899223 TAATAGGCTCAGGGTTCTGTGGG + Intergenic