ID: 1006059802

View in Genome Browser
Species Human (GRCh38)
Location 6:31411590-31411612
Sequence CTGACACCCACCACAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059802_1006059810 5 Left 1006059802 6:31411590-31411612 CCTGAGCCTGTGGTGGGTGTCAG 0: 1
1: 0
2: 6
3: 30
4: 326
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059802_1006059808 -1 Left 1006059802 6:31411590-31411612 CCTGAGCCTGTGGTGGGTGTCAG 0: 1
1: 0
2: 6
3: 30
4: 326
Right 1006059808 6:31411612-31411634 GGCAGGAGAGGAAGCCTTCAGGG 0: 1
1: 2
2: 2
3: 56
4: 400
1006059802_1006059807 -2 Left 1006059802 6:31411590-31411612 CCTGAGCCTGTGGTGGGTGTCAG 0: 1
1: 0
2: 6
3: 30
4: 326
Right 1006059807 6:31411611-31411633 AGGCAGGAGAGGAAGCCTTCAGG No data
1006059802_1006059809 4 Left 1006059802 6:31411590-31411612 CCTGAGCCTGTGGTGGGTGTCAG 0: 1
1: 0
2: 6
3: 30
4: 326
Right 1006059809 6:31411617-31411639 GAGAGGAAGCCTTCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059802 Original CRISPR CTGACACCCACCACAGGCTC AGG (reversed) Intronic
900031555 1:376318-376340 TTGGCACCCACCAAAGGGTCCGG - Intergenic
900052106 1:604518-604540 TTGGCACCCACCAAAGGGTCCGG - Intergenic
900497906 1:2984669-2984691 CTGAAACCCACCACAGACAGAGG + Intergenic
901186058 1:7374076-7374098 CGGACTTCCACCACAGGCTGTGG - Intronic
902795156 1:18796091-18796113 CTGACATCCATCACGGGGTCAGG + Intergenic
902895627 1:19477860-19477882 CTGACACACACCACAGCACCTGG + Intronic
903037676 1:20504377-20504399 CTGACACCCAGCACAGTGCCTGG - Intronic
903283730 1:22264512-22264534 CTGACCCCGAGCACAGGCCCAGG - Intergenic
903806471 1:26009312-26009334 CTCACACCCAGCAGAGCCTCAGG - Intergenic
904051927 1:27645142-27645164 CAGTGACCCAGCACAGGCTCTGG - Intergenic
904479564 1:30785462-30785484 CCACCACCCACCACAGGGTCGGG + Intergenic
904540237 1:31227878-31227900 CTGACACACCCCACTGGTTCAGG - Intronic
904615216 1:31745906-31745928 CTGCCACCCAGCCCAGCCTCTGG + Intronic
904774418 1:32898029-32898051 CTGCTTACCACCACAGGCTCTGG + Intronic
905926247 1:41751916-41751938 CCTCCACCCACCACAGGCTTTGG - Intronic
906318819 1:44804368-44804390 CTGACCCACACCAGAGGCTCTGG - Exonic
906580405 1:46930862-46930884 CTGCCTCCCACCCCAGGGTCCGG + Intronic
906603318 1:47148026-47148048 CTGCCTCCCACCCCAGGGTCCGG - Intronic
907394129 1:54177859-54177881 CTGACACCTGCCACATTCTCAGG + Intronic
907490700 1:54807103-54807125 CTGACTCCTCCCACAGGGTCTGG + Intronic
907940507 1:59082899-59082921 CCCACACCCAGCACAGGGTCTGG + Intergenic
910549935 1:88464130-88464152 CTGACAACTTTCACAGGCTCAGG - Intergenic
910931839 1:92450496-92450518 CAGACACCCATCCCAGTCTCTGG + Intergenic
911260070 1:95675015-95675037 CTGGCAACCACCACAGTTTCTGG - Intergenic
913251212 1:116913103-116913125 CTCACACCCACCAGCCGCTCAGG - Intronic
914405151 1:147363190-147363212 CTCACCCCCCCGACAGGCTCTGG - Intergenic
915049625 1:153054674-153054696 CTGGCACCTACCACAGGGTATGG + Intergenic
915092119 1:153433884-153433906 CTGACACCAATTACAAGCTCAGG - Intergenic
915231021 1:154445369-154445391 CTGACCCCCAACACAGCCTGTGG - Intronic
915543317 1:156582310-156582332 CTGGCACCCAGCACAGGGGCAGG - Exonic
915869604 1:159544075-159544097 CTGCACCCCACAACAGGCTCTGG - Intergenic
916715864 1:167446250-167446272 CCGCCCCCCACCACTGGCTCTGG + Intronic
918005094 1:180534531-180534553 CTGCCATCCACCCCAGGCCCTGG - Intergenic
920660680 1:207911649-207911671 CTCACACACAGCACAGGATCTGG - Intergenic
920971329 1:210745866-210745888 CTACCACCCACCACAGGCCTGGG - Intronic
922612427 1:226940302-226940324 CTGACGCCCGCCACGCGCTCCGG - Intronic
923280346 1:232437644-232437666 CTGACCCCCAGCCCAGGCTGAGG + Intronic
1063134615 10:3205977-3205999 CTGCCACCGACCAAAGGCACGGG + Intergenic
1063134639 10:3206105-3206127 CTGCCACCGACCAAAGGCACGGG + Intergenic
1063134651 10:3206169-3206191 CTGCCACCGACCAAAGGCACGGG + Intergenic
1063134661 10:3206233-3206255 CTGCCACCGACCAAAGGCACAGG + Intergenic
1063134685 10:3206361-3206383 CTGCCACCGACCAAAGGCACGGG + Intergenic
1063299184 10:4836407-4836429 CTGAGACCCACCCCAGCCTGTGG - Intronic
1063524834 10:6775345-6775367 CTCACACCCACCACATGCCCTGG + Intergenic
1064096228 10:12426578-12426600 CTGTCACCCAGCCCAGGCTGGGG + Intronic
1064799340 10:19051455-19051477 ATGGCAGCCACCACAGGCTTGGG + Intronic
1064816624 10:19272686-19272708 CCTCCACCCACCACAGGCTCCGG + Intronic
1064901233 10:20297726-20297748 CAGACAACCAACACAGCCTCAGG + Intergenic
1066104666 10:32146022-32146044 CTGCCTCCCACAACAGGCTTTGG - Intergenic
1067171000 10:43905707-43905729 CTGAACGCCACCACAGACTCAGG + Intergenic
1067458350 10:46439542-46439564 CTGACCCCCAAGACTGGCTCAGG - Intergenic
1067628848 10:47945092-47945114 CTGACCCCCAAGACTGGCTCAGG + Intergenic
1067702246 10:48582292-48582314 CTGAAACCCATCACAGGGACTGG + Intronic
1068105452 10:52609292-52609314 CTGAAACCCTTAACAGGCTCAGG - Intergenic
1070485872 10:76930973-76930995 CTGACCCTCACCACAGTCCCTGG - Intronic
1070853026 10:79583205-79583227 ATGCCACCCAGCACAGGCCCTGG + Intergenic
1070888056 10:79922100-79922122 ATGCCACCCAGCACAGGCCCTGG - Intergenic
1071885149 10:89941530-89941552 CAGACACCACCCATAGGCTCAGG - Intergenic
1073739875 10:106394269-106394291 CTGACACCACTCACTGGCTCCGG + Intergenic
1074511541 10:114117118-114117140 TTGGCAGCCACCACAGGCTTGGG + Intergenic
1075036668 10:119075102-119075124 CAGGCACCCACCACAGGGCCCGG + Intronic
1076313182 10:129522431-129522453 CGGGCACCCACCCCAGCCTCAGG - Intronic
1076690221 10:132219905-132219927 AGGACATCCACCACAGGCTCAGG + Intronic
1076751649 10:132546412-132546434 CCGAGACCCACCAGGGGCTCAGG - Intronic
1076792990 10:132786539-132786561 CTCACACCCACCCCAGCCACGGG - Intergenic
1076888629 10:133273691-133273713 CCCACCCCCACCACAGGCTTAGG + Intronic
1077168257 11:1153362-1153384 CTGACACCGGCCCCAGGCTGGGG + Intergenic
1078013713 11:7594068-7594090 CTGGAACCCACCCCAGGCTATGG + Intronic
1078403156 11:11045366-11045388 CTGGCAGCCACCACAGGAACTGG - Intergenic
1078984668 11:16581437-16581459 CTTCCACCCTCCACAGGCCCTGG - Intronic
1080854082 11:36096581-36096603 CTGACATGTAGCACAGGCTCAGG - Intronic
1083396767 11:62398042-62398064 CTGAACACCACCACAGGCGCTGG + Intergenic
1083614100 11:64018044-64018066 CTCACCCCCTCCTCAGGCTCTGG - Intronic
1083956147 11:65983943-65983965 CTGACACCCACCTGAGGTTCTGG + Intergenic
1084980231 11:72824980-72825002 GTGGCTCCCACCACAGGCTGTGG - Intronic
1085463406 11:76708635-76708657 CTGACACCGAGCTCAGGCTCTGG + Intergenic
1085512090 11:77093530-77093552 CTGCCTCCCACCACAGACTTGGG - Intronic
1089464402 11:118675380-118675402 CTGACACCAGCCACAAGTTCAGG + Intronic
1090224624 11:125062792-125062814 CCCAAACACACCACAGGCTCAGG - Intergenic
1090236467 11:125151966-125151988 CTCAGCCCCATCACAGGCTCTGG + Intergenic
1092808385 12:12248990-12249012 GTGGCAGCCACCACAGGCTCGGG + Intronic
1093522521 12:20067213-20067235 ATAACTCCCACCAGAGGCTCAGG + Intergenic
1094091640 12:26656442-26656464 CCGACACACACCGCAGGATCAGG + Exonic
1094379892 12:29831327-29831349 CTGCCACCCTGCACAGCCTCAGG - Intergenic
1095620424 12:44247848-44247870 CTGACACTCACCAGAGGGTTGGG + Intronic
1097170910 12:57111966-57111988 CTGGTTCCCACCACAGTCTCAGG - Intronic
1098541668 12:71664016-71664038 GTCACACCCACCGCAGGGTCTGG + Exonic
1101728680 12:107408856-107408878 CTGGCACCCAGCACAGCATCTGG - Intronic
1101848137 12:108380114-108380136 TCAACACCCACCACAGCCTCCGG + Intergenic
1101882616 12:108635764-108635786 CTGGCATTGACCACAGGCTCAGG - Intergenic
1102042279 12:109808543-109808565 CTGCCCGCCACCACAGTCTCTGG - Intronic
1102952524 12:117040190-117040212 ATGACACCCAGAACAGGCTCAGG - Intronic
1103722467 12:122982091-122982113 CTGACTTACACCACAGGATCTGG + Intronic
1104232318 12:126897333-126897355 CAGACCCCCACCCCAGTCTCAGG - Intergenic
1106357143 13:28994055-28994077 CTGCCACCCACAACAGTCGCCGG + Intronic
1106544187 13:30716050-30716072 ATGACAGCCACCACATGCTAAGG + Intronic
1106574927 13:30965943-30965965 CTGACACCCACCTCTGCCCCAGG + Intronic
1107600809 13:42010567-42010589 CTGACACCTACCACTGACTTGGG + Intergenic
1110430394 13:75416795-75416817 GTGTCACCCTCCACTGGCTCAGG + Intronic
1112494493 13:99894323-99894345 CTGTCACCCACGCCTGGCTCAGG - Exonic
1112656941 13:101461551-101461573 CAGTCACCCACCACTGGGTCTGG - Intronic
1114363794 14:22005154-22005176 CTCCCACCCACAACAGGCCCTGG + Intergenic
1116450891 14:45064074-45064096 CTGACCCCCACCCCCCGCTCTGG + Intronic
1116547445 14:46186565-46186587 CTCACCCCCGCCACAGGCCCTGG + Intergenic
1116680860 14:47968311-47968333 CTGAAACCCCCGACAGGCCCCGG + Intergenic
1118995949 14:70836113-70836135 CAGACACCCACCACAAGCTCTGG - Intergenic
1119645896 14:76348279-76348301 CAGACACCCACCACAGGGCTGGG - Intronic
1120593547 14:86405698-86405720 GAGACACCCAACACAGGTTCTGG + Intergenic
1121011569 14:90523055-90523077 CTGGCAACCACCACAGGCTCAGG - Intergenic
1121144055 14:91568202-91568224 CTCACTCCCACCTCAGCCTCTGG + Intergenic
1121541910 14:94734030-94734052 CTTAGACCCACGACAGACTCAGG + Intergenic
1121850477 14:97217884-97217906 GTGACTCCCTCCACAGGCCCTGG - Intergenic
1122400594 14:101465116-101465138 CCGCCACCCAGCAGAGGCTCAGG + Intergenic
1122819155 14:104332627-104332649 CTGCCACCCAACCCATGCTCTGG + Intergenic
1123029887 14:105446624-105446646 CCGACTCCCAGCAAAGGCTCAGG - Intronic
1123066077 14:105620128-105620150 CTGACACCCACCTCTCGCTTCGG + Intergenic
1123067837 14:105627205-105627227 CTCACCTGCACCACAGGCTCTGG + Intergenic
1123070221 14:105639181-105639203 CTGACACCCACCTCTCGCTTCGG + Intergenic
1123071855 14:105645930-105645952 CTCACCTGCACCACAGGCTCTGG + Intergenic
1123072637 14:105649212-105649234 CTCACCTGCACCACAGGCTCTGG - Intergenic
1123074811 14:105662840-105662862 CTGACACCCACCTCTCGCTTCGG + Intergenic
1123089458 14:105735965-105735987 CTGACACCCACCTCTCGCTTCGG + Intergenic
1123091519 14:105744206-105744228 CTCACCTGCACCACAGGCTCTGG + Intergenic
1123092663 14:105748738-105748760 CTCACCTGCACCACAGGCTCTGG - Intergenic
1123095246 14:105764125-105764147 CTGACACCCACCTCTCGCTTCGG + Intergenic
1123097287 14:105772547-105772569 CTCACCTGCACCACAGGCTCTGG + Intergenic
1123098223 14:105776439-105776461 CTCACCTGCACCACAGGCTCTGG - Intergenic
1125686630 15:41567445-41567467 CTGCCACCAACTACAGCCTCAGG + Exonic
1126476993 15:49075988-49076010 CTTAAACTCACCACAGGCTCTGG + Intergenic
1128056077 15:64701166-64701188 CTGACACCCACTACAGGAATAGG + Intronic
1128619472 15:69136757-69136779 CTGATGCCTACCACAGGCACTGG - Intergenic
1130701946 15:86193105-86193127 TTGACACCCATCACAGTATCTGG - Intronic
1132601519 16:775113-775135 CAGCCACCCCCCACACGCTCCGG + Intronic
1132678281 16:1129669-1129691 CAGCCCCCCACCCCAGGCTCCGG + Intergenic
1133125110 16:3641499-3641521 CTTCCACCGACCACAGGCTTGGG + Intronic
1134045786 16:11099878-11099900 CTTAAACACAGCACAGGCTCTGG - Intronic
1134058463 16:11184531-11184553 CTAGCACCTGCCACAGGCTCTGG + Intergenic
1135316696 16:21452960-21452982 CTTACACCCAGCACTGGCTAAGG + Intergenic
1135369619 16:21885202-21885224 CTTACACCCAGCACTGGCTAAGG + Intergenic
1135442195 16:22485922-22485944 CTTACACCCAGCACTGGCTAAGG - Intronic
1135651304 16:24209052-24209074 CTGTCTCCCATCACAGCCTCTGG + Intronic
1136514588 16:30760502-30760524 CCTACACCCACCACATGCTTTGG + Exonic
1138574904 16:57901319-57901341 CTGGCAGCCACCACGGGATCTGG - Intronic
1138788099 16:59869845-59869867 CTGACTCCCGCCTCAGCCTCCGG - Intergenic
1139442087 16:66973477-66973499 CTGTCACCCACACCAGGATCGGG + Exonic
1140338544 16:74135091-74135113 CTGAATCCCACGACAGGCCCTGG - Intergenic
1142865902 17:2791329-2791351 CTGTGACCCACAGCAGGCTCTGG + Intronic
1143249281 17:5510883-5510905 CTGGCACCTACAACAGCCTCAGG + Intronic
1144826353 17:18107771-18107793 CTGACACCCTCCACAGCCTAAGG + Exonic
1145976454 17:28986858-28986880 CTGTCACCCACCGCAGCCTCTGG + Intronic
1147191833 17:38742405-38742427 CAGACAGCCAACAGAGGCTCAGG + Intronic
1148850187 17:50550819-50550841 GTGGCACCCAACACAGGCTCCGG - Exonic
1152233463 17:79126289-79126311 CTGGCCCCCACCCCAGACTCTGG - Intronic
1152948098 17:83209395-83209417 TTGGCACCCACCAAAGGGTCCGG + Intergenic
1153193438 18:2568390-2568412 ATGGCAGTCACCACAGGCTCAGG + Intronic
1153256267 18:3174653-3174675 CTGAAACCCACCACAAGGGCAGG - Intronic
1154300316 18:13186172-13186194 CTGTCACCCAGCCCAGGCCCAGG + Intergenic
1155666317 18:28313757-28313779 CTGACACCTAGCACAGTCGCTGG + Intergenic
1156488298 18:37480674-37480696 CTGACATCCACAGGAGGCTCTGG - Intronic
1156496819 18:37531185-37531207 CTGACAACCTCCACAGGTACTGG + Intronic
1156551472 18:38023628-38023650 CCCACTCCCACCACAGCCTCAGG + Intergenic
1157746854 18:50143492-50143514 CTGACACCAGCCACAGGATGGGG + Intronic
1159935996 18:74368050-74368072 CTGCCACCCAGGACTGGCTCAGG - Intergenic
1160617509 18:80143404-80143426 CTTTCAGACACCACAGGCTCTGG - Intronic
1160681521 19:413581-413603 CTGCCTCCCACTCCAGGCTCAGG + Intergenic
1160880706 19:1318766-1318788 CTAACACCCACGTCAGGCCCCGG + Intergenic
1162113798 19:8415956-8415978 CTGATGCCCACCACAGGGGCTGG + Intronic
1162235117 19:9302918-9302940 CTCCCACCCACCTCAGCCTCCGG - Intronic
1165394015 19:35554245-35554267 CTGACCACGACCACAGGCTGTGG + Intronic
1165959941 19:39525414-39525436 CAGACACCAGCCACAAGCTCTGG - Intergenic
1167044436 19:47041370-47041392 CTCACAGCCTCCTCAGGCTCAGG + Intronic
1167048701 19:47066465-47066487 CAGACACCCAAGACGGGCTCAGG - Exonic
1167125914 19:47548576-47548598 CAGACACCTACCAGAGACTCAGG + Intronic
1168361745 19:55746542-55746564 CTGATAGCCACCACAGGATCTGG + Intergenic
925911189 2:8574628-8574650 CTGATGCCCACCTCAGGTTCTGG + Intergenic
927705336 2:25293246-25293268 CTGCCACCCCCCACAGGCCCTGG + Intronic
927887185 2:26725727-26725749 CTGACCCCCTCCACAGCGTCGGG - Intronic
931261602 2:60624713-60624735 CCCACACCCACCATGGGCTCTGG - Intergenic
934058870 2:88275616-88275638 CTACCCCCCACCACAGGCCCTGG + Intergenic
936688494 2:114857569-114857591 CTCACAACCATCCCAGGCTCTGG + Intronic
937014110 2:118587844-118587866 ATGCCACCCACCAAATGCTCGGG - Intergenic
937294800 2:120803623-120803645 CAGACACCCAGGACAGGCCCTGG - Intronic
937324710 2:120983572-120983594 CTGACAGCCACGGCAGGCCCAGG - Intronic
938113701 2:128589366-128589388 CTGTCACCCACCCCAGGCCAAGG - Intergenic
938645235 2:133323858-133323880 CTGAGATCAACCAAAGGCTCAGG - Intronic
939663854 2:144925091-144925113 CTGTCATCCTCCACAGACTCAGG - Intergenic
939923296 2:148143606-148143628 CTAATACCCACAACAGGCCCTGG + Intronic
942491243 2:176491310-176491332 CTGACACCCACATTTGGCTCAGG - Intergenic
942883691 2:180895879-180895901 CTCACACCCTTCTCAGGCTCTGG + Intergenic
944316601 2:198291772-198291794 ATGACACCCACAGCAGGATCTGG - Intronic
944422099 2:199542294-199542316 CTGGCATCCAACACAGGGTCTGG + Intergenic
947911377 2:233803065-233803087 CTGACTCTCTCCACAGGCTTTGG - Intronic
948569009 2:238905560-238905582 CTGAAACCCACCACTGGCCAGGG + Intronic
948681774 2:239640033-239640055 CTGCCTCTCACCACTGGCTCAGG + Intergenic
949052547 2:241904892-241904914 CTGACAACACCCACAGACTCAGG - Intergenic
1169003251 20:2183868-2183890 CTGACACCCAGCATAGGACCTGG - Intergenic
1170573892 20:17648257-17648279 CTCACTTCCCCCACAGGCTCAGG - Intronic
1170739173 20:19038969-19038991 CTCACCCCCACAACAGGCCCCGG - Intergenic
1171401576 20:24875942-24875964 CTCACACCCACCCCAGCCCCTGG + Intergenic
1172120962 20:32598513-32598535 CTGACACCCAGCACTGGGCCTGG + Intronic
1172145117 20:32752159-32752181 CTGACACCCAACACAGGACCTGG - Intergenic
1172694142 20:36810060-36810082 CTGAGGCCCACGACAGCCTCCGG - Exonic
1172701770 20:36857744-36857766 CAGACACCCAGCACAGGGCCTGG + Intronic
1172770650 20:37380641-37380663 CTGACACCCACTAGGTGCTCTGG - Intronic
1173101375 20:40091846-40091868 CTGTCACCCTGCACAGCCTCAGG - Intergenic
1173365275 20:42379541-42379563 CTGCTGCCCTCCACAGGCTCAGG - Intronic
1174373977 20:50113106-50113128 ATGGCAGCCACCACGGGCTCGGG - Intronic
1177539779 21:22477460-22477482 CTGACACCTCCCACAGCCCCAGG + Intergenic
1177758157 21:25372432-25372454 CTGACATCCAGCACATGCTGTGG + Intergenic
1178136212 21:29630337-29630359 ATGACACCCACCATATTCTCAGG - Intronic
1180060450 21:45382345-45382367 CAGGCGCCCACCAAAGGCTCTGG - Intergenic
1180181281 21:46119719-46119741 CCCCCACCCTCCACAGGCTCTGG + Intronic
1181013785 22:20056929-20056951 CTGACACACTCCCCAGGCGCCGG - Intronic
1181474113 22:23158127-23158149 CTCACACCCACCACGGGGTCAGG - Intronic
1182257308 22:29048545-29048567 GTGACACACACCGCAGGCTTGGG + Intronic
1183370920 22:37431901-37431923 GTGACACCCCGCACAAGCTCTGG - Intergenic
1184091683 22:42296253-42296275 TTGACCCCCAGCACAGGCCCTGG + Intronic
1184164479 22:42719783-42719805 CTGAGACCCACCAGGTGCTCGGG + Intronic
1184686765 22:46099757-46099779 CTGGCACCCACCATAAGCCCAGG + Intronic
1184974332 22:48050407-48050429 CTGACCCTCACCCCAGCCTCTGG - Intergenic
1185020841 22:48373972-48373994 CTGACTCCCACCAGAGCCCCAGG - Intergenic
1185080325 22:48706100-48706122 CTGTCACCCACACCAGGCCCAGG - Intronic
1185095982 22:48806330-48806352 CTCACACCCACCCCAGCCCCAGG - Intronic
949578881 3:5366442-5366464 CTGACACCAACCGCAAGTTCAGG - Intergenic
950361172 3:12450470-12450492 CTGACTCCCTCTACAGGTTCTGG - Intergenic
950523886 3:13512447-13512469 CTGGCACCCAACACAGGGCCTGG - Intergenic
951243511 3:20314220-20314242 CTGACACCAACCACAAGTTCAGG - Intergenic
953472021 3:43175766-43175788 CCGACACTCCCCAGAGGCTCTGG + Intergenic
954864418 3:53716988-53717010 CTGAGGCCCAGCCCAGGCTCAGG - Intronic
955636805 3:61039188-61039210 CTGACACACAGCAAATGCTCAGG + Intronic
956959115 3:74376690-74376712 CTGACACCCACCCCAGTCCATGG + Intronic
958619059 3:96532997-96533019 CCCACCCCCACCACAGGCCCTGG - Intergenic
961256308 3:125556524-125556546 CTGACTCACACCAAATGCTCTGG + Intronic
961826505 3:129601906-129601928 CTGGCACCCACCACAGAGCCTGG + Intronic
962355976 3:134694542-134694564 CTCACACCCAGCACAGGCCCAGG - Intronic
962797053 3:138858614-138858636 CTGATCCCCACCACAGGCAGAGG - Intergenic
964212936 3:154248024-154248046 CTGGCACACACAACAGGCTGTGG + Intronic
964302550 3:155305355-155305377 CTCACCCCCACTACAGGCCCCGG - Intergenic
964669043 3:159205130-159205152 CTGACACCAACCACAAGTTTGGG + Intronic
964919638 3:161880826-161880848 CTGATACCAACTACAGGTTCAGG - Intergenic
964952108 3:162308306-162308328 CTGACTGCCACCACAGACCCAGG - Intergenic
966057930 3:175718646-175718668 ATGGCAGCCACCACGGGCTCGGG - Intronic
967214698 3:187200087-187200109 CTGGCACCCTCGACAGGCTCTGG - Exonic
967776662 3:193392627-193392649 CTGCCACCAACCTCAGGGTCAGG - Intergenic
968059256 3:195714507-195714529 CTCAAACCCACCACTGGCACTGG + Intergenic
968685092 4:1952520-1952542 CTCACACATAGCACAGGCTCAGG - Intronic
969137691 4:5043872-5043894 CTGACACATAACACAAGCTCAGG + Intergenic
969578879 4:8052373-8052395 CTGAGACCCAGCGCAGCCTCAGG + Intronic
969857293 4:10010469-10010491 CAGACACCAGCGACAGGCTCAGG - Intronic
969868813 4:10092479-10092501 CCGACGCCTCCCACAGGCTCTGG + Intronic
972231897 4:37082468-37082490 CTTTCACTCCCCACAGGCTCTGG - Intergenic
973914351 4:55618375-55618397 CCAACACCCCCGACAGGCTCCGG + Intronic
974197916 4:58600596-58600618 CTGACACCAGCCACAAGCTTGGG + Intergenic
976274466 4:83261906-83261928 CTGGCACCCACCAAGTGCTCTGG + Intronic
977152864 4:93535020-93535042 CTCACCTCCACCCCAGGCTCTGG + Intronic
979687526 4:123527244-123527266 CTGAGACCCACCACACCCACTGG - Intergenic
981226759 4:142305447-142305469 AAGAGACCCACCTCAGGCTCAGG + Exonic
983561890 4:169109901-169109923 CTCCCTCCCACCTCAGGCTCCGG - Intronic
985033528 4:185816283-185816305 CTGGGACCCACCAAAGGATCTGG + Intronic
985333456 4:188866800-188866822 CTGGAACTCCCCACAGGCTCTGG - Intergenic
985634243 5:1028173-1028195 CTGATCCCCGCCACAGGCACCGG - Intronic
986164714 5:5263788-5263810 CTGCCCCCCACTACAGGGTCAGG - Intronic
987014681 5:13805874-13805896 CAGACACCAGCCACAAGCTCAGG - Intronic
991204806 5:64038502-64038524 CTGCCACCCTGCACAGGCTCTGG + Intergenic
992006411 5:72482651-72482673 CTGTGGTCCACCACAGGCTCCGG + Intronic
995154638 5:108895716-108895738 CTGACAAACACTACAGGTTCTGG + Intronic
995642433 5:114273030-114273052 CCAACACCCCCCACAGGCCCTGG + Intergenic
996235795 5:121127943-121127965 CTGCCACCCTGCACAGTCTCAGG + Intergenic
996571314 5:124935273-124935295 CAGACACCAGCCACAGGCTCTGG + Intergenic
997604380 5:135163562-135163584 CTGACACCGAGCACATGCCCTGG - Intronic
999177893 5:149644617-149644639 CTGACACCCAGCACAGGATCTGG + Intergenic
1000021420 5:157322298-157322320 CTGACACCCACCCAGGGCTCTGG + Intronic
1000156676 5:158559073-158559095 CTGGGACCCACCACAGTCTGTGG + Intergenic
1001282966 5:170401067-170401089 CTGAGTCCCACCCCAGGCTGAGG - Intronic
1001879820 5:175233631-175233653 CTGACCTCCAGCACAGGGTCTGG + Intergenic
1001982880 5:176048301-176048323 CTGACACCCACCTGAGGCCTGGG + Intergenic
1002234583 5:177795756-177795778 CTGACACCCACCTGAGGCCTGGG - Intergenic
1002742265 5:181442550-181442572 TTGGCACCCACCAAAGGGTCCGG + Intergenic
1002787824 6:417818-417840 CTGCCCACCAGCACAGGCTCTGG + Intergenic
1005755499 6:28922118-28922140 CTGCCACCCACAAGAGACTCAGG + Intronic
1005898083 6:30195446-30195468 CTGACACCCACCCCATGGCCTGG + Intronic
1005922640 6:30415747-30415769 CTAACACCCACCCCAGGGTGAGG - Intergenic
1006059802 6:31411590-31411612 CTGACACCCACCACAGGCTCAGG - Intronic
1006072292 6:31506661-31506683 CTAACTCCCACACCAGGCTCAGG - Intronic
1006456122 6:34133036-34133058 ATGACACCCACCACACGTTCAGG + Exonic
1007605591 6:43115792-43115814 CTGACACCCGCCACAGTGCCAGG - Intronic
1007861104 6:44909737-44909759 CTGACACCTAGCTCAGGCCCAGG + Intronic
1008119538 6:47596423-47596445 CTCACAACCACTTCAGGCTCTGG + Intronic
1008937990 6:57013182-57013204 CTGACACCAACTACACGTTCAGG + Intronic
1010557106 6:77296029-77296051 CTGCCAACCACCCCAGCCTCTGG + Intergenic
1011101684 6:83729023-83729045 CCAACCCCCACAACAGGCTCTGG - Intergenic
1017954460 6:159167452-159167474 CTGAAGTCCAGCACAGGCTCTGG + Intergenic
1018034093 6:159866907-159866929 CTGACAGCCAGCCCGGGCTCAGG + Intergenic
1018431033 6:163723171-163723193 GTGACACCCACCCCCAGCTCAGG + Intergenic
1018830589 6:167439860-167439882 CTCACTCCCTCCAAAGGCTCTGG - Intergenic
1018993499 6:168692740-168692762 CTGGCTCCCTCCACAGGCCCGGG + Intergenic
1019071347 6:169348061-169348083 CTCACCCCCATGACAGGCTCCGG + Intergenic
1019247401 6:170718288-170718310 TTGGCACCCACCAAAGGGTCCGG + Intergenic
1022190872 7:28015927-28015949 CTCACACCCACCACAGGCCCGGG + Intronic
1024655504 7:51448294-51448316 CAGAAGCCCCCCACAGGCTCTGG + Intergenic
1024996703 7:55278067-55278089 CTGACACCCACCACGTGGCCAGG - Intergenic
1027868574 7:83677341-83677363 CTGGGACCTACCACAGTCTCTGG + Intergenic
1027872113 7:83720481-83720503 AGGCTACCCACCACAGGCTCAGG + Intergenic
1028274814 7:88841698-88841720 CTGACACCAACCAAAAGCTCAGG - Intronic
1028484285 7:91341184-91341206 CTGACACCCACCAGAATCTAAGG + Intergenic
1032667900 7:134055312-134055334 CTGCAACCCACTACAGCCTCTGG - Intronic
1034107561 7:148503269-148503291 CTGTAACCCATCACAGGCTCTGG + Intergenic
1034250873 7:149689652-149689674 CAGAAAACCACCCCAGGCTCTGG - Intergenic
1034405064 7:150897456-150897478 CAGACACCCACCCCAGGCTCAGG + Intergenic
1034959044 7:155352850-155352872 CTGCCACCCACAAAAGGCTGCGG - Intergenic
1035404660 7:158589087-158589109 CTGCCACCCACCACCCCCTCCGG - Intergenic
1035439602 7:158885198-158885220 CTGACCCCCACCCCCAGCTCTGG - Intronic
1035500735 8:89648-89670 TTGGCACCCACCAAAGGGTCGGG - Intergenic
1035854268 8:2957454-2957476 CTGGCTCCCTCCAGAGGCTCTGG + Intronic
1036033804 8:4997589-4997611 CTCACACTCTCCACAGCCTCAGG + Intergenic
1039074536 8:33677884-33677906 CCCACACCCACAAGAGGCTCAGG - Intergenic
1039499334 8:38004262-38004284 CTGACACCCACCACCACATCAGG - Intergenic
1039562271 8:38522199-38522221 CTGACACCCCACACAGGATATGG - Intronic
1040495486 8:47961350-47961372 CAGACACCCACAGCAGGCTGTGG + Intronic
1042889245 8:73588944-73588966 ATGACACCCACCACAATCCCAGG + Intronic
1043369633 8:79575636-79575658 CTAACACACCCCTCAGGCTCTGG - Intergenic
1043593037 8:81852010-81852032 CTCACCCCCACAACAGGCCCTGG - Intergenic
1044491643 8:92825198-92825220 CTGTCACCTACCACAGTGTCTGG + Intergenic
1045063775 8:98427988-98428010 CCGACACGTCCCACAGGCTCTGG - Exonic
1045503070 8:102758061-102758083 CTGACACCCACCCTGGGCTCGGG - Intergenic
1046652432 8:116851943-116851965 CTTACAGGCATCACAGGCTCTGG + Exonic
1047037724 8:120957663-120957685 CTGACACCCTTCACAGCATCTGG + Intergenic
1047361522 8:124173555-124173577 CTGGCACCCAGCACAGTGTCTGG - Intergenic
1048497226 8:134945417-134945439 GTGACACCCAATCCAGGCTCAGG - Intergenic
1048627806 8:136205459-136205481 CCGACCCCCACAACAGGCCCTGG - Intergenic
1048969712 8:139638687-139638709 CCTGCACCCACCTCAGGCTCTGG + Intronic
1048976706 8:139677218-139677240 CTAACACCCAGCACAGGCACAGG - Intronic
1049187584 8:141266064-141266086 CTGACACACACCTCAAGCTTGGG + Intronic
1049216029 8:141408823-141408845 CTGGCACCCACCCAGGGCTCAGG + Intronic
1049365334 8:142234285-142234307 ATGACCCCAACCACAGGTTCAGG + Intronic
1049888109 9:41833-41855 CTCACCCCCACAACAGGCCCTGG + Intergenic
1051444890 9:17129488-17129510 CAGACACCCACCACCGCCCCCGG - Intergenic
1052990814 9:34518513-34518535 CTCAAGCCCACCACAGCCTCTGG - Intronic
1053617324 9:39781577-39781599 CTGCCACCCCCCGCTGGCTCCGG + Intergenic
1053875506 9:42540940-42540962 CTGCCACCCCCAACTGGCTCTGG + Intergenic
1056824357 9:89866233-89866255 CCCACATCCTCCACAGGCTCAGG - Intergenic
1059411388 9:114134605-114134627 CTGATCCCCACCCCAGGCACTGG + Intergenic
1060146771 9:121259744-121259766 ATGAGACCCACGAAAGGCTCTGG - Intronic
1060530359 9:124344104-124344126 CTGACGCACACCAGAGGCTGTGG - Intronic
1060643831 9:125261674-125261696 CGGACACCCACGACAGCCTCAGG + Intergenic
1061226471 9:129283672-129283694 CTCACTCCCATCACAGGGTCTGG - Intergenic
1061618052 9:131793013-131793035 CTGACACCCCCTTCAGCCTCCGG + Intergenic
1061733572 9:132636198-132636220 CAGACAGCTCCCACAGGCTCTGG + Intronic
1062436858 9:136550226-136550248 CCGACCCACACCAGAGGCTCCGG + Intergenic
1062634232 9:137481535-137481557 ATCACAGCCACCAGAGGCTCAGG + Intronic
1203608174 Un_KI270748v1:73765-73787 TTGGCACCCACCAAAGGGTCCGG + Intergenic
1187377033 X:18764390-18764412 AGGACACCCACCTCAGGCCCAGG - Intronic
1189291717 X:39890765-39890787 CTGACCCCCACCACAGGCCCAGG + Intergenic
1190693307 X:52930585-52930607 CCCCCACCCACCACAGGCCCTGG - Intronic
1191049050 X:56171526-56171548 CTGAACCCCACAACAGGCCCCGG + Intergenic
1192166522 X:68830369-68830391 CTGCCACCCACCCCAAGCGCCGG - Intronic
1192184138 X:68935072-68935094 CTGCCAGCCTCCACAGGCTCTGG - Intergenic
1193419377 X:81265363-81265385 CCCACACCCGCCACAGGCCCCGG + Intronic
1197180928 X:123535827-123535849 CCCCCACCCACAACAGGCTCTGG - Intergenic
1198406627 X:136319220-136319242 CTGAGCCCCACCGCAGCCTCTGG - Intronic
1199329581 X:146543136-146543158 CTGACCCCCTGCACAGCCTCAGG - Intergenic
1201491174 Y:14542967-14542989 CCCACCCCCACCACAGGCCCTGG - Intronic
1201564072 Y:15347704-15347726 CTGACACCAATCACAAGCTCAGG - Intergenic