ID: 1006059803

View in Genome Browser
Species Human (GRCh38)
Location 6:31411591-31411613
Sequence CTGAGCCTGTGGTGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059797_1006059803 -9 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371
1006059794_1006059803 21 Left 1006059794 6:31411547-31411569 CCAGTGTTGTAATCAGGGCAAGT 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371
1006059796_1006059803 -8 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371
1006059793_1006059803 25 Left 1006059793 6:31411543-31411565 CCATCCAGTGTTGTAATCAGGGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG 0: 1
1: 1
2: 4
3: 43
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059803 Original CRISPR CTGAGCCTGTGGTGGGTGTC AGG Intronic
900098539 1:951100-951122 GTGAGGCTGTGGTGGGCGTGTGG - Intronic
900497905 1:2984668-2984690 CTCTGTCTGTGGTGGGTTTCAGG - Intergenic
900777580 1:4596207-4596229 CTCAGACTGTAGTGGGTGGCTGG - Intergenic
900995542 1:6121452-6121474 CTGGGCCTGTGGTGTGTGTGGGG - Intronic
901079244 1:6574554-6574576 CTGGCCCTGTGCTGGGTGTGGGG - Intronic
901186059 1:7374077-7374099 CACAGCCTGTGGTGGAAGTCCGG + Intronic
901239053 1:7682346-7682368 CTGGCCCTGGGGTAGGTGTCTGG + Intronic
902887769 1:19418596-19418618 CGGAGCCTGTGGAGGGAGTTGGG - Intronic
902991045 1:20187063-20187085 CTGACCCTGTGGTGGGTGGTGGG + Intronic
903283731 1:22264513-22264535 CTGGGCCTGTGCTCGGGGTCAGG + Intergenic
903806472 1:26009313-26009335 CTGAGGCTCTGCTGGGTGTGAGG + Intergenic
904255937 1:29255007-29255029 CTGAGCCAGTGGTGGTTGGGGGG + Intronic
904843390 1:33389153-33389175 TTGTGCATGTGGTGGGTGTTTGG + Intronic
904942866 1:34177227-34177249 CTGGGCCGGGGGTGGGAGTCGGG + Intronic
910238610 1:85062062-85062084 CTGAGATTGCGGTGGGTGTGAGG + Intronic
910340169 1:86177790-86177812 CTGAGCATGTGCTGTGTGCCAGG - Intergenic
911367549 1:96956630-96956652 CTGAGGATGTGGTGGATGTTGGG + Intergenic
912454105 1:109786438-109786460 CTGAGCATGTGCTGTGTGCCAGG + Intergenic
912710924 1:111949215-111949237 CTGGGCCTTTGGTGGATCTCCGG + Intronic
913211339 1:116585034-116585056 CTGAGCCTCAGGCGGCTGTCTGG + Exonic
915004500 1:152623628-152623650 GAGAGGCTGTGGTGGGTGGCCGG - Intergenic
915543318 1:156582311-156582333 CTGCCCCTGTGCTGGGTGCCAGG + Exonic
915676209 1:157534573-157534595 CTCAGCCAGGGGTGGGTGACTGG + Intronic
915686086 1:157636255-157636277 CTGGGCCAGGGGTGGGTGACTGG + Intergenic
916031843 1:160883733-160883755 TTAAGCCTGTGCTGGCTGTCAGG - Intronic
917451793 1:175153469-175153491 CTGAGTCTGTAGTGGAAGTCAGG + Intergenic
917596886 1:176538270-176538292 TTGAGCATGTGTTAGGTGTCAGG + Intronic
917720203 1:177779803-177779825 CTGGACCTGTCATGGGTGTCCGG - Intergenic
919802109 1:201360220-201360242 CTGAGCATTTAGTGGGTGCCAGG + Intronic
920032592 1:203046178-203046200 CTGAGGCTGGGGTGGGGGTGGGG + Intronic
920048878 1:203151321-203151343 CTGAGTCTGGGGTGGGGGTTTGG - Intronic
922613006 1:226943968-226943990 CAGAGCCTGTGGAGGGGCTCTGG + Intronic
922802240 1:228369771-228369793 CTGAGCCTGGGGTGAGTATCTGG - Intronic
923217829 1:231866085-231866107 CTGAGCCTGGTGTGTGTGTGTGG + Intronic
924330539 1:242936574-242936596 CTGAGCCTGTGGTGTGTTTGTGG - Intergenic
924421170 1:243911530-243911552 GTGAGCCTCTTGTGGGTCTCTGG + Intergenic
1062957247 10:1548402-1548424 CAGAGCCTGAGGGGGGTTTCGGG + Intronic
1063524833 10:6775344-6775366 CAGGGCATGTGGTGGGTGTGAGG - Intergenic
1063622998 10:7666680-7666702 CTGGGCCTCTGGTGGGGGCCTGG + Intronic
1064816622 10:19272685-19272707 CGGAGCCTGTGGTGGGTGGAGGG - Intronic
1064901232 10:20297725-20297747 CTGAGGCTGTGTTGGTTGTCTGG - Intergenic
1067363523 10:45603203-45603225 TTGAGCCTTTGGTAGGTGTCAGG - Intergenic
1067561110 10:47305249-47305271 CTGAGCCCTTGCTGGGTGCCAGG + Intronic
1068105453 10:52609293-52609315 CTGAGCCTGTTAAGGGTTTCAGG + Intergenic
1069047509 10:63758900-63758922 CTGAGCCCCTAGTGGGTGCCAGG + Intergenic
1069631553 10:69900141-69900163 CACAGCCTGGGGTGGGTGACAGG - Intronic
1070922195 10:80195021-80195043 CTCAGCCTGTGGTGAGAGACGGG - Intronic
1071293361 10:84202627-84202649 CTTGGCCTGTGCTGAGTGTCAGG - Intronic
1073149902 10:101304562-101304584 ATGAGCCTTTGATGGGTGTTTGG + Intergenic
1074007281 10:109440056-109440078 CTGGGCCTGTGGTGGGAGGTGGG - Intergenic
1074202876 10:111255450-111255472 CTGAGTCTGTCCTGGGTATCTGG - Intergenic
1074688086 10:115978149-115978171 CAGAGCCTTTGCTGTGTGTCAGG - Intergenic
1075257015 10:120933375-120933397 CTGAGCCTGTGGTGTAAATCTGG - Intergenic
1076160122 10:128237294-128237316 CTGAGCCTGCAATGGGTGACTGG - Intergenic
1076749478 10:132535479-132535501 CTGAACCTGTGGTGGGTGAGGGG + Intergenic
1076888627 10:133273690-133273712 CTAAGCCTGTGGTGGGGGTGGGG - Intronic
1077431479 11:2517928-2517950 CTGAGCCTGTGGTGTGCGGTGGG + Intronic
1078613825 11:12846253-12846275 CTGAGCCTGTGGAGGCTCTGGGG - Intronic
1082781917 11:57294631-57294653 CAGAGCCTTTGTTGGGAGTCAGG - Intergenic
1083381581 11:62273748-62273770 CTGTGCCTGTGGTGGGACTGGGG + Intergenic
1083700460 11:64474076-64474098 CAGAGACTCTGGTGGGGGTCTGG + Intergenic
1083844676 11:65324195-65324217 CTGGGGGAGTGGTGGGTGTCTGG - Intergenic
1083956146 11:65983942-65983964 CAGAACCTCAGGTGGGTGTCAGG - Intergenic
1084220216 11:67673437-67673459 CAGAGCCAGGGGTGGGTCTCTGG - Intronic
1084373742 11:68762290-68762312 CTGAACAGGTGGTTGGTGTCAGG - Intronic
1084859159 11:72006925-72006947 CTGAGCCTGTGCAGGGTGAAGGG - Intronic
1084859739 11:72010701-72010723 CTGGGGCCGTGGGGGGTGTCGGG - Intronic
1084944715 11:72632432-72632454 CAGTGACTGTGGTGTGTGTCTGG + Intronic
1086610088 11:88745303-88745325 CTGAGGCTGAGGTGGGTGGGTGG - Intronic
1086839575 11:91667890-91667912 GTGGGCCTGTGCTGGGAGTCTGG - Intergenic
1087385784 11:97466794-97466816 CTGAGGCAGGGGTGGGGGTCAGG - Intergenic
1090224626 11:125062793-125062815 CTGAGCCTGTGGTGTGTTTGGGG + Intergenic
1090951657 11:131478908-131478930 CTATGCCTGTGTTGGGTGTTGGG + Intronic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1094484610 12:30914653-30914675 CTGAGCCTGGGGTGGGAGGGTGG + Intergenic
1096155427 12:49339026-49339048 CTGGGCCTGTGTTGGGGGTTGGG + Intergenic
1096792089 12:54051737-54051759 CTGAGCCTGGGGTGGGGCTGGGG + Intronic
1097802137 12:63926279-63926301 CTGAGCCTATGCTGTGTGTTGGG + Intronic
1100259001 12:92914125-92914147 CTGAGGGTGTGGTGGGGGTAGGG - Intronic
1102597908 12:114006788-114006810 CTGAGCCTGAGTTGTGTGTGTGG - Intergenic
1104623873 12:130337729-130337751 TTGGGCCTGTGCCGGGTGTCCGG + Intergenic
1104793547 12:131499675-131499697 GTGAGGCTGTGGTTGGTGTGAGG + Intergenic
1104948333 12:132427373-132427395 CGGGGCCTGGGGTGGGTGGCGGG + Intergenic
1104948390 12:132427526-132427548 CAGGGCCTGGGGTGGGTGGCTGG + Intergenic
1104950515 12:132437793-132437815 CCGAGCCTGAGGTGTGTGGCTGG - Intergenic
1106242342 13:27921655-27921677 CTGCGCCTGGGGTCAGTGTCAGG - Intronic
1106557132 13:30819214-30819236 CTCAGCCTAGGCTGGGTGTCTGG + Intergenic
1106570601 13:30923947-30923969 CTCTGCCTGTCGTGGGTGCCAGG - Intronic
1106844875 13:33727801-33727823 CTGAGCCTGTGGAGGGGTTGGGG + Intergenic
1110747146 13:79067592-79067614 CTGTGCCTGTTCTGGGAGTCTGG + Intergenic
1112409719 13:99152362-99152384 CTGTGCCTGAGCTGGGTCTCAGG - Intergenic
1112494494 13:99894324-99894346 CTGAGCCAGGCGTGGGTGACAGG + Exonic
1113406285 13:110043573-110043595 CTGAGTGTGTGGTGTGTGTGTGG - Intergenic
1113791104 13:113028815-113028837 GTGAGCCTGTGGTGTGTGTGGGG + Intronic
1113962958 13:114135424-114135446 CTGAGCTGGAGGTGGGTGGCAGG - Intergenic
1115205000 14:30893243-30893265 CTGAGGCTGAGGTGTGAGTCCGG - Intronic
1117518296 14:56524524-56524546 CCAAGCCTGGGGTAGGTGTCTGG + Intronic
1117714104 14:58563224-58563246 CTGTGTTTGAGGTGGGTGTCGGG - Intergenic
1118712139 14:68528788-68528810 GTGAGCATCTGTTGGGTGTCAGG + Intronic
1119190616 14:72679603-72679625 GTCAGCCTGTGGAGGGTGGCGGG - Intronic
1119645898 14:76348280-76348302 CCAGCCCTGTGGTGGGTGTCTGG + Intronic
1119773509 14:77235666-77235688 GGGAGACTGTGGTGGGTGGCGGG + Intronic
1120808779 14:88781429-88781451 CTGAGTCTGTGGTGTGTGCAAGG - Intronic
1121010477 14:90517380-90517402 CTGAGCCTGTGTGGGGTGCTGGG - Intergenic
1121011570 14:90523056-90523078 CTGAGCCTGTGGTGGTTGCCAGG + Intergenic
1121324328 14:93011275-93011297 CTAAGCCTGTGCTGGGTGAGGGG + Intronic
1121438044 14:93931834-93931856 TTGACCCAGCGGTGGGTGTCGGG - Intergenic
1121541909 14:94734029-94734051 CTGAGTCTGTCGTGGGTCTAAGG - Intergenic
1121780314 14:96617906-96617928 GTGAGCCTGTGGGTGGAGTCAGG + Intergenic
1122155051 14:99745854-99745876 CTGAGCCTGTGCTGTGTGCATGG + Intronic
1122400592 14:101465115-101465137 CTGAGCCTCTGCTGGGTGGCGGG - Intergenic
1123036122 14:105472678-105472700 CTGAGGCTGCGGTGGGTCACAGG - Intergenic
1123185459 14:106512392-106512414 CTGAGAGTGTGGTGGGTGCACGG - Intergenic
1124465877 15:29939512-29939534 CTGAGCCTGTGCTAGGGGTTGGG - Intronic
1124836296 15:33198869-33198891 CTGAACCTGTGGAGGCTGACAGG + Intergenic
1125686629 15:41567444-41567466 CTGAGGCTGTAGTTGGTGGCAGG - Exonic
1126702788 15:51382984-51383006 CTGAGCCACTGGGGGGAGTCGGG - Intronic
1126969040 15:54089016-54089038 ATGAGCCTGTGGTATGTGACAGG - Intronic
1128534556 15:68480799-68480821 CTGACCCTAGGGTGGGTATCTGG + Intergenic
1128784337 15:70383737-70383759 CTGAGCATGTGTTGGGTGAGCGG - Intergenic
1128944855 15:71813242-71813264 CTGAGCCTCTGGCTGATGTCAGG + Intronic
1131529677 15:93180651-93180673 CTGGGCCTGTGGAGGCTGCCAGG + Intergenic
1132284117 15:100647789-100647811 CAGAGACCGTGGTGGGTGTCCGG + Intronic
1132715063 16:1286045-1286067 CCGGGTCTGTGGTGTGTGTCTGG - Intergenic
1132769402 16:1552510-1552532 ATGAGCCTGTGTTGTGTGTGAGG - Intronic
1133868797 16:9668859-9668881 CTGAGGCTGTGCTGGGTGGCAGG + Intronic
1134512616 16:14860506-14860528 ATGAGGCAGTGGTGGTTGTCTGG + Intronic
1134893734 16:17865163-17865185 CTGATACTGTGGTGGGTGCTGGG - Intergenic
1134971573 16:18535658-18535680 ATGAGGCAGTGGTGGTTGTCTGG - Intronic
1135163420 16:20117171-20117193 CTGATCCTTTTGTGGGTGCCAGG + Intergenic
1135641273 16:24121799-24121821 CTGAGCATGTGTTGTGTGCCAGG + Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1136514586 16:30760501-30760523 CAAAGCATGTGGTGGGTGTAGGG - Exonic
1137524351 16:49221231-49221253 CTGAGCATCTGATGGGTGCCAGG - Intergenic
1137955641 16:52826080-52826102 CTGAGCATCTGCTGTGTGTCTGG - Intergenic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1140472785 16:75224589-75224611 CTGAGCCTTTGCTGTGTGTGGGG + Intronic
1141834591 16:86530381-86530403 CTGAGGGTGGGGTGGGCGTCAGG + Exonic
1142364005 16:89640247-89640269 CAGAGCCTGTGGGGGCTGTGAGG - Intergenic
1142478932 17:206164-206186 ATGAGCCTGAGGTGGCTGTAAGG - Intergenic
1143119769 17:4599517-4599539 CTCACCCTGGGGTGGGTGTGGGG - Intronic
1143344928 17:6242450-6242472 CTGATCCTGTGCTGGGGGTATGG + Intergenic
1144520016 17:15947052-15947074 GTGAGCCTTATGTGGGTGTCTGG + Intronic
1144625941 17:16844538-16844560 CTGAGCCTGGCATGGGGGTCTGG - Intergenic
1144880492 17:18428182-18428204 CTGAGCCTGGCATGGGGGTCTGG + Intergenic
1145151743 17:20516205-20516227 CTGAGCCTGGCATGGGGGTCTGG - Intergenic
1145981393 17:29014126-29014148 CTGAGCCTGTGCCATGTGTCAGG - Intronic
1146643326 17:34557396-34557418 GTGAGTCTGTGGTGTGTATCTGG - Intergenic
1146884895 17:36464276-36464298 CTGAGCCTGGGGTTGGGGGCGGG + Intergenic
1146902529 17:36598019-36598041 CTGTGCCTGTGGCTGGTCTCCGG + Intronic
1147191832 17:38742404-38742426 CTGAGCCTCTGTTGGCTGTCTGG - Intronic
1147386722 17:40086910-40086932 ATGAGCCTGTACTGGGTGACCGG - Intronic
1148218592 17:45847349-45847371 ATGAGCCTAGGGTGGGTGGCAGG - Intergenic
1148495577 17:48051633-48051655 GTGGACCTGTGGTGGGTGTGTGG + Intronic
1148733266 17:49850790-49850812 CTGAGCGCGTGCTGTGTGTCAGG - Intergenic
1149562538 17:57619141-57619163 CTGAGCCTTTGCTCGGAGTCTGG - Intronic
1150289043 17:63971286-63971308 CAGAGCCTGGGGTGGGTGGTAGG + Intronic
1150289137 17:63971676-63971698 CTGAGGCTGGGGTGGGTGAGGGG - Intronic
1151598055 17:75089803-75089825 CCCAGCCTGGGGTGGGAGTCAGG + Intronic
1151848989 17:76678589-76678611 CTGAGCCCGTGGTGTGTGGGGGG - Intronic
1151954803 17:77374827-77374849 CTGGGCCTGAGGAGGGTGTGGGG + Intronic
1152560280 17:81075222-81075244 CTGCGCCTGTGCTGGGTCTGGGG + Intronic
1152700330 17:81815341-81815363 CAGGCCCTGTGGTGGGTGGCAGG - Intergenic
1152713251 17:81885511-81885533 CTGTGCCTGTGGTGGAGGTGGGG - Intergenic
1155829304 18:30492882-30492904 CAGAGCATGTGGAGGGTGCCGGG + Intergenic
1156293517 18:35770520-35770542 CAGAGCCTGTGCTATGTGTCAGG - Intergenic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1157289216 18:46398216-46398238 GTGTGCCTGTGGTGTGTGTGTGG + Intronic
1158422163 18:57304748-57304770 ATTGGCCTGTGGTGGGAGTCAGG + Intergenic
1159877290 18:73826970-73826992 CTGAGGCTGTGGCAGGAGTCTGG + Intergenic
1159935997 18:74368051-74368073 CTGAGCCAGTCCTGGGTGGCAGG + Intergenic
1160240426 18:77118884-77118906 CTGTGTGTGTGGTGTGTGTCTGG - Intronic
1160575378 18:79849924-79849946 CTGAGCCTGGGTGGGGTCTCGGG - Intergenic
1160681520 19:413580-413602 CTGAGCCTGGAGTGGGAGGCAGG - Intergenic
1160748833 19:724173-724195 GTGAGCGTGTGGTGGGTGCCTGG + Intronic
1161028619 19:2047942-2047964 ATGAGCCTCTGGTGGGTGGCGGG - Intronic
1161459082 19:4385858-4385880 CTGAGCGTAGTGTGGGTGTCTGG - Intronic
1162495665 19:11022056-11022078 CTGGGCCTGTGCTGGGTGCCTGG + Intronic
1162736024 19:12747599-12747621 CTGAGCCAGTGCTGGGTGGGTGG - Intronic
1163685944 19:18711667-18711689 CTGGTCCTGGGGTGGGTGCCGGG + Intronic
1164766747 19:30778140-30778162 CGGAGCCTAGGGTGGCTGTCAGG - Intergenic
1165022463 19:32935854-32935876 CGGAGCCTATGGTGGGTGGTGGG - Intronic
1165073716 19:33269555-33269577 GGGAGCCTGTGGTGGGTGTTGGG + Intergenic
1165384226 19:35501109-35501131 CTGGGGCTGGGGGGGGTGTCCGG - Intronic
1165735874 19:38175228-38175250 CTGAGCCTGTGGAAGCTGCCTGG - Intronic
1165959942 19:39525415-39525437 CAGAGCTTGTGGCTGGTGTCTGG + Intergenic
1166749070 19:45156147-45156169 CTCAGCCTCTGGTGTGTGGCTGG - Intronic
1167112412 19:47470049-47470071 CTGTGCCTGTGTTGGGGGGCTGG + Intronic
1167121175 19:47517836-47517858 CTGAGTCTGTGGTGGGTCACAGG + Intergenic
1167567811 19:50267860-50267882 CTGAGCCTGTTGGGGCTGTAGGG + Intronic
1168255257 19:55161413-55161435 TTGAGCCTGGGGTGGGGGGCGGG + Exonic
1168261308 19:55196613-55196635 CTGTGTCTGTGTTGGGTCTCGGG - Exonic
1168364996 19:55778663-55778685 CTAAGCCTGTGACGGGTCTCTGG + Intergenic
1202659162 1_KI270708v1_random:52028-52050 CTGAGCCTGTGGTGGCAGGGGGG + Intergenic
927962387 2:27249211-27249233 CTGAGCATGTACTTGGTGTCTGG + Intergenic
928292383 2:30050797-30050819 ATGAGCCTGCTGTGGGGGTCTGG - Intergenic
928419455 2:31126548-31126570 CTGAGCCTGTAGTAAGTGTTGGG - Intronic
929264973 2:39908447-39908469 CTGAACCTCTGCTAGGTGTCAGG - Intergenic
929998879 2:46847613-46847635 CTGCCCCTGGGGTGGGTCTCTGG - Intronic
930740110 2:54823654-54823676 GTTAGGCTGTGGTGGGTTTCTGG + Intronic
930971267 2:57397995-57398017 CTGAGCCAGGGGTGGCTTTCCGG + Intergenic
931707696 2:64961018-64961040 CTCAGTCTGTGGTGGGTGTCTGG + Intergenic
932300956 2:70666740-70666762 CTCAGCCCCTGGTGTGTGTCTGG + Intronic
932596195 2:73095004-73095026 CTGAGCACCAGGTGGGTGTCAGG - Intronic
932704189 2:74010420-74010442 CTGTGCCGGTGGTGGCTGTGGGG - Intronic
932882046 2:75511754-75511776 CTGAGCATCTGATGGGTGCCAGG + Intronic
933941335 2:87247514-87247536 CTGAGGCTGTGGTGGGGTTCAGG + Intergenic
934640142 2:96023047-96023069 CTGTGTCTGTGCTGGGTGCCAGG - Intronic
934793503 2:97082353-97082375 CTGTGTCTGTGCTGGGTGCCAGG + Intergenic
936338887 2:111614074-111614096 CTGAGGCTGTGGTGGGGTTCAGG - Intergenic
936473456 2:112819227-112819249 GTGAGCGTGTGGTGGGTGGGTGG + Intergenic
937037872 2:118796789-118796811 CTGAGCCAGGAGTGGGTGCCTGG - Intergenic
937983946 2:127630238-127630260 CTGTGCCTGTGGTACGAGTCTGG + Intronic
938265071 2:129922770-129922792 CTGAGCCTGGAGGGGGTGGCCGG + Intergenic
938611919 2:132956894-132956916 CTGAGCCTGGGGAGAGTGTCTGG - Intronic
938688877 2:133768262-133768284 CTAAGCCTATGATGGGTGTGTGG + Intergenic
940343283 2:152603153-152603175 CTGTGCCTGTGGAATGTGTCAGG + Intronic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
946332752 2:219019478-219019500 CTGAGCCTGGAGTGGGGGTGGGG - Intronic
947499968 2:230664660-230664682 CTGATCCTGAGGTGGGGGGCAGG - Intergenic
948145710 2:235706973-235706995 CTGAGCGCTTGCTGGGTGTCAGG + Intronic
948675672 2:239595145-239595167 CTGAGGCTGGGCTGGGTGTCGGG + Intergenic
948704474 2:239780330-239780352 ATGGGCACGTGGTGGGTGTCCGG - Exonic
949052548 2:241904893-241904915 CTGAGTCTGTGGGTGTTGTCAGG + Intergenic
1169366292 20:4995482-4995504 CTGAGGATGTGATGGGGGTCAGG - Intronic
1170187284 20:13604878-13604900 CTGAGTCTGTGGTGAGTGTATGG - Intronic
1172145118 20:32752160-32752182 CAGGTCCTGTGTTGGGTGTCAGG + Intergenic
1172701769 20:36857743-36857765 CAGGCCCTGTGCTGGGTGTCTGG - Intronic
1173101376 20:40091847-40091869 CTGAGGCTGTGCAGGGTGACAGG + Intergenic
1173111770 20:40197662-40197684 CTGAGCCTTTTGTGGGGGACAGG - Intergenic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1173997039 20:47346377-47346399 CCCAGCCTGTGCTGGGTGGCAGG - Intronic
1174113730 20:48213322-48213344 GCGACCCTGTGGTGGGTGTCAGG + Intergenic
1175880936 20:62258645-62258667 CGGAGGCTGTGGTGGCTGCCAGG + Intronic
1175893737 20:62326997-62327019 CTGAGCCTGTGGCCAGAGTCTGG - Intronic
1175976851 20:62715204-62715226 CTGAGGCTGTGGGGGGTGAGAGG + Intronic
1176164487 20:63665545-63665567 CTGGGCCTGTTGTGGTTGGCAGG + Intronic
1177539778 21:22477459-22477481 CTGGGGCTGTGGGAGGTGTCAGG - Intergenic
1179129601 21:38622898-38622920 CTGAGCATGTGGTGTATGTATGG - Intronic
1179598110 21:42456792-42456814 CTGAGCCTGAGGAGGGAGTGTGG - Intergenic
1179999984 21:44991201-44991223 CTGAGGCCGGGGCGGGTGTCCGG + Intergenic
1180090189 21:45530380-45530402 GTGAGCGTGTGGTGTGTGTGTGG + Intronic
1180928733 22:19574295-19574317 CTGAGGCTGTTGGGGGTGTGTGG + Intergenic
1181157997 22:20936764-20936786 TTGAGGCTGTGGTGGGGGTCAGG + Intronic
1181316435 22:21973701-21973723 CTGAGGCTTTGCTGTGTGTCGGG + Intronic
1181512211 22:23394112-23394134 CTGAGCCGGGGGTGGGTGCCAGG + Intergenic
1181787173 22:25235813-25235835 CCTAGCCTCTGGTGGGTGGCCGG - Intergenic
1182362173 22:29753080-29753102 CTGTGCCTGGGGAGGCTGTCCGG + Intronic
1182974906 22:34614372-34614394 CAGAGACTGTGCTGGGTGTGAGG - Intergenic
1183386477 22:37518327-37518349 CTGTGTCTGTGGGGGGTGTTGGG - Intronic
1183598916 22:38828758-38828780 CTCAGGCTGTGGTGGGGGTGTGG + Intronic
1184115549 22:42419772-42419794 CTGAGCCACTCCTGGGTGTCTGG + Intronic
1184686764 22:46099756-46099778 CTGGGCTTATGGTGGGTGCCAGG - Intronic
1184894759 22:47400397-47400419 CTGAGCATGAGCTGTGTGTCTGG - Intergenic
1185020842 22:48373973-48373995 CTGGGGCTCTGGTGGGAGTCAGG + Intergenic
1185050545 22:48551924-48551946 CTGAGCCCCTGGTGGGAGTTGGG + Intronic
1185189705 22:49427519-49427541 CTGGGCCAGTGGTGAGTGTGGGG - Intronic
949416533 3:3820963-3820985 CTGAGCCTGTGAGTGGTGGCAGG + Intronic
950542491 3:13620730-13620752 ATGAGACCCTGGTGGGTGTCTGG + Intronic
950620256 3:14199845-14199867 GTGAGCCTGTGGTGTGGGTGTGG + Exonic
953135624 3:40179277-40179299 CTGGGCCTTTTGTGGTTGTCAGG + Intronic
953614383 3:44477452-44477474 CTGCGCCCGTGGCGGGGGTCTGG - Intronic
953956473 3:47235667-47235689 CAGAGCCTGTGGTGTGCATCAGG + Intronic
954379820 3:50213480-50213502 CTGAGGCGGTGCTGGGTGGCTGG - Intronic
954955151 3:54512264-54512286 CTGAGCCTTTTGTGGGAGTAGGG - Intronic
955609082 3:60738474-60738496 CTGAGCCTGTGCTTGGTACCTGG - Intronic
955636804 3:61039187-61039209 CTGAGCATTTGCTGTGTGTCAGG - Intronic
959045133 3:101465234-101465256 CTGAGCCAGTGGCGGGGGTGAGG - Intronic
962355977 3:134694543-134694565 CTGGGCCTGTGCTGGGTGTGAGG + Intronic
962378405 3:134877389-134877411 CTGACCCTGCTGTGGGGGTCAGG - Intronic
962797054 3:138858615-138858637 CTCTGCCTGTGGTGGGGATCAGG + Intergenic
965473875 3:169130345-169130367 TTGAGCCTGAAGAGGGTGTCTGG - Intronic
967175543 3:186860329-186860351 CTGAGCCTGAGCTTGGTGCCTGG - Intergenic
967776663 3:193392628-193392650 CTGACCCTGAGGTTGGTGGCAGG + Intergenic
967911099 3:194543182-194543204 TTGTGCCTGTGGTGGGGGGCAGG - Intergenic
968089958 3:195893508-195893530 CTGAGGCCGTGGTCTGTGTCAGG - Intronic
968130474 3:196190156-196190178 CTGAGCCTTTGGTGGGGGCCTGG - Intergenic
968329397 3:197852851-197852873 CGGTGCCTCTGGTGGGGGTCAGG - Intronic
968533037 4:1105318-1105340 CTGGGGATGTGGTGGGTGGCTGG - Intronic
968628573 4:1638737-1638759 CTGAGCCTGGCCTGGGTGTGTGG - Intronic
968684778 4:1950498-1950520 GTCAGCCTGTGGTGTGAGTCCGG + Intronic
968685093 4:1952521-1952543 CTGAGCCTGTGCTATGTGTGAGG + Intronic
969220088 4:5753548-5753570 CTGACCCTGGGGTGGGGGTGGGG + Intronic
969282391 4:6179475-6179497 CGGTGCCTGTAGGGGGTGTCAGG - Intronic
969439578 4:7209179-7209201 CTGAGCATATGCTGGCTGTCCGG - Intronic
969468903 4:7374857-7374879 GTGACCCTGTGCTGGGTGTGTGG + Intronic
969566950 4:7984365-7984387 GTGAGCCTGTGGGAGGTGTCAGG + Intronic
969578878 4:8052372-8052394 CTGAGGCTGCGCTGGGTCTCAGG - Intronic
969862482 4:10048501-10048523 ATGAGCGTGGGGTGGGTGTGGGG - Intronic
970177628 4:13355371-13355393 CTGTTCCTGGGGTGGGGGTCAGG - Intergenic
971092341 4:23360505-23360527 CTGAGCCTGTGGGGGCAGTGGGG - Intergenic
972562152 4:40238328-40238350 GCGAGCCTGTGGAGGGCGTCAGG + Intronic
973914349 4:55618374-55618396 CGGAGCCTGTCGGGGGTGTTGGG - Intronic
974120400 4:57631343-57631365 CTGATCCTGTGGTGAGTCACTGG - Intergenic
975585751 4:75946854-75946876 CTGGGCCTGTGGAGGATCTCTGG + Intronic
984102214 4:175499719-175499741 CTGAGCCTGTGGGGGAAGTGGGG + Intergenic
985634448 5:1028889-1028911 CTGAGGCTTTGGTGGGTGCCGGG + Intronic
985646045 5:1085193-1085215 CTGAGCCGTGGGTGGGTGTGGGG - Intronic
986073046 5:4306306-4306328 CAGAGCTTGTCCTGGGTGTCAGG + Intergenic
986262520 5:6160645-6160667 CTGGGCCTGGGGAGGCTGTCAGG + Intergenic
986297943 5:6455240-6455262 CTGACCAGGTTGTGGGTGTCAGG - Intronic
986737405 5:10678312-10678334 CTGAGTCTGTGGAGGGCGTGTGG + Intergenic
993959174 5:94275817-94275839 CTGAGGGTGTGGTGGATGCCAGG - Intronic
995642431 5:114273029-114273051 CAGGGCCTGTGGGGGGTGTTGGG - Intergenic
996235794 5:121127942-121127964 CTGAGACTGTGCAGGGTGGCAGG - Intergenic
996789912 5:127281706-127281728 CTGTGCCTGTGGCAGATGTCTGG + Intergenic
997894240 5:137701857-137701879 CAGAGTCTGAGGTGGCTGTCTGG - Intronic
998104077 5:139457253-139457275 CTGAGCATGTGGAGGCTGTGGGG - Intronic
999112367 5:149133046-149133068 CTGAGCGTGTGCTGTGTGCCAGG - Intergenic
999400741 5:151262457-151262479 CTGAGCATGTCCTGGGTGCCAGG - Intronic
999449916 5:151670169-151670191 GTCAGCCTGTGGCTGGTGTCTGG + Intronic
1000021419 5:157322297-157322319 CAGAGCCCTGGGTGGGTGTCAGG - Intronic
1000284568 5:159815943-159815965 CTGAGCCTCTGTTGTATGTCAGG - Intergenic
1001240969 5:170069561-170069583 ATTGGCCTGTGCTGGGTGTCGGG - Intronic
1002067123 5:176657440-176657462 CTGAGGCTGAGGTGGGTTCCTGG - Intronic
1002446928 5:179295650-179295672 CTGAGTCTGTGGTGGTTGCAGGG - Intronic
1002940730 6:1713383-1713405 GTGGGCCGGTGGTGGGTGCCAGG - Intronic
1003107600 6:3227900-3227922 CTGGGGCTGTGGTGGGGGTCTGG + Intronic
1003122777 6:3331338-3331360 CTGAGCTTCTGGTGTGTGTCAGG - Intronic
1005922641 6:30415748-30415770 CTCACCCTGGGGTGGGTGTTAGG + Intergenic
1006059803 6:31411591-31411613 CTGAGCCTGTGGTGGGTGTCAGG + Intronic
1006072293 6:31506662-31506684 CTGAGCCTGGTGTGGGAGTTAGG + Intronic
1008792962 6:55261550-55261572 GTGAGCCTGTAATTGGTGTCTGG + Intronic
1011101686 6:83729024-83729046 CAGAGCCTGTTGTGGGGGTTGGG + Intergenic
1011728337 6:90233764-90233786 ATGAGCCTGTGGATGGGGTCAGG - Intronic
1012343470 6:98156993-98157015 CTGAGGTTGTGGTGGGGGTGGGG - Intergenic
1015217819 6:130770339-130770361 CTGAGCATGTCGGGGGGGTCTGG - Intergenic
1017351554 6:153448614-153448636 CTTAGCTTGTGATGGGTCTCAGG + Intergenic
1018345261 6:162892901-162892923 CTGAGGCTGAGGTGGTTCTCTGG - Intronic
1018479295 6:164173899-164173921 CTGAGCCTTTGGAGAGTGCCAGG - Intergenic
1019101488 6:169634337-169634359 CTGAGCATCTCGTGAGTGTCAGG - Intronic
1019339938 7:504231-504253 CTCTGCCTGTGGTGGGTGGGTGG - Intronic
1019590287 7:1827423-1827445 CTGAGCCCGTCGCGGGTGTGGGG + Intronic
1019590299 7:1827456-1827478 CTGAGCCCGTCGCGGGTGTGGGG + Intronic
1022126994 7:27368053-27368075 CTGAGTGTGTGGTGTGTGTGTGG - Intergenic
1022190870 7:28015926-28015948 CCGGGCCTGTGGTGGGTGTGAGG - Intronic
1022278079 7:28876129-28876151 CTGAGCCTGAGAGGGCTGTCTGG + Intergenic
1023110553 7:36806627-36806649 TGGAGCATGTGGTGGGTGCCGGG - Intergenic
1023275862 7:38517993-38518015 GTGAGCCTGTGGAGGGTGGAGGG - Intronic
1024143871 7:46491240-46491262 CTGAGCTTCTAGTGTGTGTCTGG + Intergenic
1027275166 7:76549218-76549240 CTGGGACCGCGGTGGGTGTCCGG + Intergenic
1027394358 7:77739133-77739155 GTGAGCCTGTGGTGGTGGTAGGG + Intronic
1032198901 7:129805344-129805366 CTGAGCCTGTGGCCTGTCTCCGG + Intergenic
1032667088 7:134047509-134047531 TTGTGCCTTTGGGGGGTGTCTGG - Intronic
1033223609 7:139544372-139544394 CTAGGCCTGTGGGAGGTGTCTGG + Exonic
1034250874 7:149689653-149689675 CAGAGCCTGGGGTGGTTTTCTGG + Intergenic
1034405063 7:150897455-150897477 CTGAGCCTGGGGTGGGTGTCTGG - Intergenic
1034415773 7:150963597-150963619 CTGAGGCTGGGGTGGGAGTGGGG - Intronic
1036033803 8:4997588-4997610 CTGAGGCTGTGGAGAGTGTGAGG - Intergenic
1036142981 8:6225463-6225485 CTGGGCTTGTGGAGGGTGGCAGG - Intergenic
1036227247 8:6970351-6970373 CTGAACCTCTGGTGGTTGCCTGG - Intergenic
1036604346 8:10292843-10292865 AGGAGCCGGTGGTGGGTGTGAGG + Intronic
1036766643 8:11553703-11553725 CTGAGGCTGGGGTGGGGGTGTGG + Intronic
1037969318 8:23160847-23160869 TTGTGCTTCTGGTGGGTGTCCGG - Intronic
1038275415 8:26117037-26117059 CTGAGCAGGGGGTGGGGGTCTGG - Intergenic
1038699936 8:29840558-29840580 TTGGGCTTGTGTTGGGTGTCAGG - Intergenic
1039074538 8:33677885-33677907 CTGAGCCTCTTGTGGGTGTGGGG + Intergenic
1039499335 8:38004263-38004285 CTGATGTGGTGGTGGGTGTCAGG + Intergenic
1040907376 8:52482031-52482053 CAGAGACTGTGGTGGGAGTCGGG + Intergenic
1041036822 8:53800080-53800102 CTGAGTCTCTGATGGGTTTCCGG + Intronic
1041491454 8:58437958-58437980 CTGGGCCTGTGATGGGGGTTGGG - Intronic
1042368833 8:67967919-67967941 CTGAGCCTGTCGTGGGGTTGGGG + Intronic
1046063751 8:109172699-109172721 CTCAGGCTGTGTTTGGTGTCAGG - Intergenic
1046889971 8:119412036-119412058 CTGACCCTGAGGTGGATGTTGGG + Intergenic
1047569219 8:126079502-126079524 CTGGCACAGTGGTGGGTGTCTGG + Intergenic
1048514411 8:135092965-135092987 CTGAGTCAGTGGTGGCTATCTGG + Intergenic
1048627808 8:136205460-136205482 CAGGGCCTGTTGTGGGGGTCGGG + Intergenic
1049335524 8:142082558-142082580 GTGTGCCTGGGGTGTGTGTCTGG - Intergenic
1049335529 8:142082588-142082610 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335625 8:142083118-142083140 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335658 8:142083330-142083352 GTGTGTCTGTGGTGTGTGTCTGG - Intergenic
1049418916 8:142508252-142508274 CTGTGCCTGGGGTGGGTCTCAGG + Intronic
1049442681 8:142616448-142616470 CTGAGCCTGTAGGTGTTGTCTGG + Intergenic
1049518937 8:143078431-143078453 CTGAGCCTGTGGCTGATGACAGG - Intergenic
1049572866 8:143377809-143377831 GTGAGCCAGTGCTGGGTGTGTGG - Intronic
1049578124 8:143398819-143398841 CTGGGCCTGTGGGGAGGGTCTGG + Intergenic
1056400181 9:86219784-86219806 ATGAGCATGGGGTGGGTATCTGG - Intergenic
1056729011 9:89147869-89147891 TGGAGCCTGTGCTGGGTGTCTGG - Intronic
1056824359 9:89866234-89866256 CTGAGCCTGTGGAGGATGTGGGG + Intergenic
1056949753 9:91032656-91032678 CTGGCCCTGGGGTGGGTGTTGGG - Intergenic
1057353672 9:94319099-94319121 CTGACCCTTTGTTGGGGGTCAGG + Exonic
1057654078 9:96938493-96938515 CTGACCCTTTGTTGGGGGTCAGG - Exonic
1057967287 9:99516562-99516584 CTGACACTGTGGTGGTAGTCAGG - Intergenic
1058102281 9:100930318-100930340 CTGAGCATCTAGTGGGTGCCTGG - Intergenic
1059254949 9:112921389-112921411 CTGAGGCTTTGGTGTGTGTTTGG - Intergenic
1059304058 9:113340187-113340209 CTGAGCCTGAGGTGGGAGAAAGG - Intronic
1059464807 9:114461313-114461335 TTGACACTGTGGTGTGTGTCCGG + Intronic
1059884473 9:118730186-118730208 TTAGGCTTGTGGTGGGTGTCTGG - Intergenic
1060137251 9:121169445-121169467 CTGGGCCTTTGGTGTGGGTCAGG + Intronic
1060209526 9:121701130-121701152 GTGTGCATGTGGTGGTTGTCCGG + Intronic
1060643830 9:125261673-125261695 CTGAGGCTGTCGTGGGTGTCCGG - Intergenic
1060661984 9:125409648-125409670 CTGTGTGTGTGGTGTGTGTCTGG - Intergenic
1060783015 9:126427296-126427318 ATGTTCTTGTGGTGGGTGTCAGG + Intronic
1060831368 9:126719764-126719786 CTGAGCTGGTGCTGGGTGCCTGG - Intergenic
1061403571 9:130381744-130381766 CTGGGGCTGTGGTGGTTGGCGGG - Intronic
1062083110 9:134634821-134634843 CTGAGCCTGTGCTCTGTGCCCGG + Intergenic
1185705260 X:2262103-2262125 CTGAGGCTGGGCTGGGTGTGTGG - Intronic
1186272606 X:7905454-7905476 CTGAGCATCTAGTGTGTGTCTGG + Intronic
1186960347 X:14729773-14729795 CTGAGCCTGTGCTGTGTGCCTGG - Intronic
1187078364 X:15959160-15959182 CTGTTCCTGTGGTGGTTGGCTGG + Intergenic
1190107317 X:47569744-47569766 CTGTGCCAGATGTGGGTGTCTGG + Intronic
1190693309 X:52930586-52930608 CAGGGCCTGTGGTGGGTGGGGGG + Intronic
1192184139 X:68935073-68935095 CAGAGCCTGTGGAGGCTGGCAGG + Intergenic
1197100528 X:122648242-122648264 CTGAGCAAGTGCTGTGTGTCAGG - Intergenic
1198214233 X:134542600-134542622 CTGAGCAGTTGGTGGGTGTTTGG - Intergenic
1198274402 X:135087723-135087745 CTGATCCTGTGGTGGGCACCAGG - Intergenic
1198341192 X:135714388-135714410 CTAAGCCTATGGTGGGACTCAGG + Intronic
1198346719 X:135767190-135767212 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198348626 X:135784478-135784500 CTAAGCCTATGGTGGGACTCAGG - Intergenic
1198350530 X:135801748-135801770 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198352438 X:135819015-135819037 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198354347 X:135836283-135836305 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198356256 X:135853537-135853559 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198358170 X:135870811-135870833 CTAAGCCTATGGTGGGACTCAGG - Intergenic
1198360084 X:135888089-135888111 CTAAGCCTATGGTGGGACTCAGG - Intronic
1198360680 X:135892601-135892623 CTGAGCCTGTGGTGGGACTCGGG - Intronic
1198591521 X:138188454-138188476 ATGAGACTTTGGTGGGTGTGGGG + Intergenic
1199597283 X:149516179-149516201 CTGAGCCTGTCCTGGGAGTTGGG - Intronic
1201227896 Y:11835707-11835729 CTGAGCCTGTGGTGTGTTTGTGG - Intergenic
1201491176 Y:14542968-14542990 CAGGGCCTGTGGTGGGGGTGGGG + Intronic