ID: 1006059804

View in Genome Browser
Species Human (GRCh38)
Location 6:31411595-31411617
Sequence GCCTGTGGTGGGTGTCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 369}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059798_1006059804 -8 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059793_1006059804 29 Left 1006059793 6:31411543-31411565 CCATCCAGTGTTGTAATCAGGGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059794_1006059804 25 Left 1006059794 6:31411547-31411569 CCAGTGTTGTAATCAGGGCAAGT 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059797_1006059804 -5 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369
1006059796_1006059804 -4 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG 0: 1
1: 0
2: 3
3: 37
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059804 Original CRISPR GCCTGTGGTGGGTGTCAGGC AGG Intronic
900031558 1:376323-376345 CCCTTTGGTGGGTGCCAAGCGGG + Intergenic
900052109 1:604523-604545 CCCTTTGGTGGGTGCCAAGCGGG + Intergenic
900176041 1:1291783-1291805 GCCTGGGGTGGGTCTCAAGGAGG + Exonic
900375716 1:2353705-2353727 GGCTGTGGTGGGGGCCTGGCAGG + Intronic
901057670 1:6456255-6456277 GCCTCTGGAGGGCGTCAGACAGG - Intronic
901436573 1:9250489-9250511 GCCTGTGGTGTGTGTGGGGTGGG - Intronic
901532366 1:9861576-9861598 GCCTGTGGTGGTTGTCAGCCTGG - Intronic
902476683 1:16692200-16692222 GCCTCTGGAGGGCGTCAGACAGG + Intergenic
902744252 1:18462877-18462899 GCCTGTTGGGGGTGTGGGGCAGG + Intergenic
902928889 1:19716593-19716615 CCCTGGTGTGGGTGTCAGACAGG + Intronic
903017333 1:20369425-20369447 GCCCCTGGTGGGGGTGAGGCAGG - Intergenic
903732095 1:25504044-25504066 ACCTCTGCTGGGTGGCAGGCGGG - Intergenic
904171337 1:28593718-28593740 GAATGTGGTGGGTGTCCTGCTGG + Exonic
904467381 1:30716386-30716408 GTGTGTGGTGGGTGTCCAGCCGG - Intronic
904843391 1:33389157-33389179 GCATGTGGTGGGTGTTTGGCAGG + Intronic
904982038 1:34513330-34513352 GCCTGTTGTGGGTTGCAGGGAGG - Intergenic
905929429 1:41776877-41776899 GAGTGTAGTGGGTGACAGGCAGG + Intronic
906108583 1:43308853-43308875 GCCTTTGCTGGTTTTCAGGCTGG + Intronic
906723773 1:48028641-48028663 GCCGGTGGTGGGTCTGAGGCGGG - Intergenic
908104339 1:60825775-60825797 GCCTGTGGTGTCAGGCAGGCTGG - Intergenic
910053500 1:83004410-83004432 GCCAGTGATTGGTCTCAGGCTGG - Intergenic
910463291 1:87470670-87470692 GCCTGTGCTGGGGGTCTGGCAGG + Intergenic
913405891 1:118490049-118490071 GCAAGTGGAGGGTGTCAGACTGG + Intergenic
913446937 1:118960130-118960152 GCCTGTGGTTTGAGTGAGGCGGG + Intronic
914047946 1:144105943-144105965 GCCTGGGCTGGCTGTCTGGCTGG + Intergenic
915004499 1:152623624-152623646 GGCTGTGGTGGGTGGCCGGCTGG - Intergenic
915523627 1:156463209-156463231 TCCTGTGGGGTGTGTCAGGTGGG + Intergenic
915686087 1:157636259-157636281 GCCAGGGGTGGGTGACTGGCAGG + Intergenic
915773295 1:158454134-158454156 GCCTGTGGTTGGTGAGGGGCTGG + Intergenic
915836751 1:159182954-159182976 GCCTGTGGTGGGTGTTAAGGTGG - Intronic
916031842 1:160883729-160883751 GCCTGTGCTGGCTGTCAGGTCGG - Intronic
919795677 1:201320174-201320196 GAGTGTGGTGGGGGACAGGCAGG - Intronic
920316252 1:205077473-205077495 GCCTAGGGTGGGTGTCACCCAGG - Exonic
920439508 1:205969936-205969958 GCCTGAGCTTGGAGTCAGGCAGG - Intergenic
922526421 1:226308334-226308356 CCCTAGGGTGGGTGTCAGGCAGG + Intronic
1062802616 10:391318-391340 ACCTGTCATGGGTGCCAGGCAGG + Intronic
1062958022 10:1552798-1552820 GCCAGGGGTGAGTGTCCGGCAGG - Intronic
1064932120 10:20639922-20639944 GCCTATGGTGAGGGGCAGGCAGG - Intergenic
1067088051 10:43253171-43253193 GTGTGGGGTGGGTGTCAGGAAGG - Intronic
1070560795 10:77565159-77565181 GCCAGTGCTGGGTGCAAGGCAGG - Intronic
1071908496 10:90202708-90202730 GTGTGTGGTGGGGGACAGGCAGG + Intergenic
1073662532 10:105492710-105492732 GCCTGTGCTGTTTGTGAGGCAGG - Intergenic
1073697588 10:105888437-105888459 CCCTGTGGTGGGTTTCATGGTGG + Intergenic
1074845276 10:117392161-117392183 GCCTGTGGTATCTGCCAGGCTGG - Intergenic
1076875978 10:133215717-133215739 GCTCGAGGTGGGTCTCAGGCTGG - Intronic
1076888626 10:133273686-133273708 GCCTGTGGTGGGGGTGGGGAAGG - Intronic
1077150692 11:1071822-1071844 GCCTAGGGTGGGCCTCAGGCTGG + Intergenic
1077407608 11:2389603-2389625 GGCTGTGCTGGGAGTCTGGCAGG - Intronic
1077431276 11:2517130-2517152 GCCCTTGGTAGGTGCCAGGCGGG + Intronic
1078551154 11:12281344-12281366 GGCTGTGGTTGGTCACAGGCTGG + Intronic
1079131631 11:17750156-17750178 GGCTGTGGTGGGTCTCAGAGGGG + Intronic
1079133102 11:17761021-17761043 GCCTGTCTTGGGTGTCGGGAGGG - Intronic
1079201879 11:18383577-18383599 GCTTGTGGTGGGGGTCGGGTCGG + Intergenic
1079633632 11:22708937-22708959 GCCTGTGGTGGGAGGCAGGATGG + Intronic
1080138411 11:28885516-28885538 GCCTGTGGGGGGTGGGAGGCTGG + Intergenic
1080797814 11:35581847-35581869 GCCTGTGCTGGTTGGAAGGCTGG - Intergenic
1081834476 11:46142884-46142906 GCCTGTGGTGGGGGTGGGGACGG - Intergenic
1081866205 11:46361994-46362016 CCCTGTGGTGAGTCTCAGCCTGG + Intronic
1083200423 11:61118139-61118161 AGGTGTGGTGGGGGTCAGGCTGG - Intronic
1083292960 11:61699928-61699950 GGCTGGGGAGGGTGGCAGGCAGG + Intronic
1083396766 11:62398037-62398059 GCCTGTGGTGGTGTTCAGCCAGG - Intergenic
1083618208 11:64036507-64036529 GCCCGTGGGGGGCGTCAGGCCGG + Intronic
1084116376 11:67045127-67045149 GGTTGGGGTGGGTGCCAGGCAGG + Intronic
1084188676 11:67488993-67489015 GTCTGTGGTGGGGGTGAGGAGGG + Intronic
1084308304 11:68300653-68300675 CCCTGTGGTGGGTCTGAGGGAGG - Intergenic
1084939620 11:72605566-72605588 GCCTGAGGCTGGAGTCAGGCAGG - Intronic
1085084332 11:73656653-73656675 GCATGGGGTGGGTGGCAGGAGGG + Intronic
1089376529 11:117999034-117999056 CCCTGTGCTGGGGCTCAGGCTGG - Exonic
1090435779 11:126685303-126685325 CCCAGTGCTGGGTGTGAGGCAGG - Intronic
1090584871 11:128200578-128200600 TCCTGTGGTTGGTGTTTGGCAGG + Intergenic
1090913964 11:131146149-131146171 GCCTGTTGGGGGGGTCAGGCTGG + Intergenic
1091232286 11:133996506-133996528 GCCTGTTGCGGGAGTCAGGCAGG - Intergenic
1091350436 11:134889904-134889926 GCCTGTGGGGTGGGTCAGGGAGG + Intergenic
1091623964 12:2108640-2108662 CCATGTGGTGGGTGGGAGGCTGG - Intronic
1091979277 12:4852662-4852684 CCCTGAGGTGGGTGTGTGGCTGG + Intergenic
1096229411 12:49888954-49888976 GCCTGTGGCAGGTGCCAGGAGGG + Intronic
1097153021 12:56993668-56993690 GGGTGTGGTGGGTGGCTGGCAGG - Intergenic
1097399057 12:59107819-59107841 GCCTGTTGTGTGTGTGAGGGAGG - Intergenic
1098673973 12:73266139-73266161 CCCTGTTGTGGGTGGCTGGCTGG - Intergenic
1100494161 12:95109380-95109402 GCCTTTGGTGGGTAGGAGGCAGG + Intronic
1101883612 12:108642500-108642522 CCCTGTGGCGAGTGTCAGGAGGG - Intergenic
1101889886 12:108703778-108703800 ACCTGTGCTGGGTGTCATCCAGG - Intronic
1103129868 12:118458797-118458819 CCCTTTGGTGGGGGTCAGGGAGG - Intergenic
1103911705 12:124355620-124355642 GCCTGGAGTGTGTGTCCGGCAGG - Intronic
1104088821 12:125497343-125497365 GCCTGTGCTGGGTGTGGGGTTGG + Intronic
1104623875 12:130337733-130337755 GCCTGTGCCGGGTGTCCGGGAGG + Intergenic
1104948337 12:132427377-132427399 GCCTGGGGTGGGTGGCGGGGGGG + Intergenic
1104948392 12:132427530-132427552 GCCTGGGGTGGGTGGCTGGGAGG + Intergenic
1106242341 13:27921651-27921673 GCCTGGGGTCAGTGTCAGGCAGG - Intronic
1106357140 13:28994050-28994072 GACTGTTGTGGGTGGCAGGAGGG - Intronic
1106802364 13:33269502-33269524 GCCTGGTGTGGGTGTCTAGCTGG - Intronic
1108072964 13:46648332-46648354 GCAGGAGGTGAGTGTCAGGCTGG - Intronic
1108433035 13:50373686-50373708 GCATCTAGTGGGTGTCAGCCAGG + Intronic
1108772716 13:53724293-53724315 GTGTGTGGTGGGTGTCATGGTGG + Intergenic
1113035114 13:106039638-106039660 GCCAGTTGTGTGTGTTAGGCTGG - Intergenic
1113781209 13:112978619-112978641 GCCTGTGCAGGGTGGCAGGACGG + Intronic
1113906193 13:113820289-113820311 GCCTGTGGTGGGGGCCGAGCAGG + Intergenic
1114363791 14:22005149-22005171 GCCTGTTGTGGGTGGGAGGAGGG - Intergenic
1116547443 14:46186560-46186582 GCCTGTGGCGGGGGTGAGGCTGG - Intergenic
1116870164 14:50062495-50062517 GCCTGGGTTGGGGCTCAGGCCGG - Intergenic
1119481679 14:74962028-74962050 GGATGTGGTGGGTCCCAGGCAGG - Intergenic
1120935513 14:89892045-89892067 GAATGTGGTGGGTGTCCTGCTGG + Intronic
1121850478 14:97217889-97217911 GCCTGTGGAGGGAGTCACGAAGG + Intergenic
1122080421 14:99263221-99263243 GCCTTTGGAGGGTGTCAGGAGGG - Intronic
1122274415 14:100584282-100584304 GCCTGGGGTGGGGATCAGCCAGG - Intronic
1122827231 14:104376230-104376252 GGATGTGGTAGGTGTGAGGCGGG - Intergenic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1122971650 14:105154688-105154710 GCCTGTGGGGGGTGGCATTCAGG - Intronic
1123036121 14:105472674-105472696 GGCTGCGGTGGGTCACAGGCAGG - Intergenic
1123040828 14:105489590-105489612 GGCTGTGGTGGGTGTGCTGCAGG + Intronic
1123123586 14:105929318-105929340 GCCTGGGGCAGGTCTCAGGCAGG - Intronic
1202854838 14_GL000225v1_random:43721-43743 GCCTGTGGTGGGGCTGCGGCCGG + Intergenic
1123406227 15:20020820-20020842 GCCTGGGGCAGGTCTCAGGCAGG - Intergenic
1123417235 15:20102813-20102835 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417246 15:20102873-20102895 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417439 15:20103692-20103714 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123417450 15:20103752-20103774 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123515557 15:21027468-21027490 GCCTGGGGCAGGTCTCAGGCAGG - Intergenic
1123526511 15:21109667-21109689 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123526522 15:21109727-21109749 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123526815 15:21110970-21110992 GCCTGTGCTGGCTGGCTGGCTGG + Intergenic
1123697970 15:22892622-22892644 CCTTGTGATAGGTGTCAGGCTGG - Intronic
1124344790 15:28914949-28914971 GCGTGTGGTGTGTGTGAGGTGGG - Intronic
1124365657 15:29069631-29069653 TCCTGTGGAGGGTCTGAGGCTGG + Intronic
1125677085 15:41507944-41507966 CCCTGTGGTGGGTGCTGGGCAGG - Intronic
1127632461 15:60839993-60840015 CCCTGTTGTGGGTAGCAGGCAGG + Intronic
1128145377 15:65329803-65329825 GCCTGTGGTGGACGTCTGGTTGG + Exonic
1128246149 15:66134214-66134236 GCCTGTTGTGGGAGGGAGGCTGG - Intronic
1129244696 15:74272164-74272186 GGAGGTGGTGGGTGTGAGGCAGG - Intronic
1130397393 15:83514826-83514848 GCTTGTTGGGCGTGTCAGGCTGG + Intronic
1130629638 15:85553748-85553770 GCAAGAGGTGAGTGTCAGGCGGG + Intronic
1130885554 15:88089832-88089854 GACTGTGGAGGGTGTAACGCAGG - Intronic
1131248771 15:90817659-90817681 GCCCGTGATGGGTCCCAGGCTGG - Intergenic
1132379076 15:101353580-101353602 GCCTCTGCTGGGTGCCAGCCAGG - Intronic
1132514941 16:361874-361896 GCCTCTGCTGGGGGTAAGGCAGG - Intergenic
1132751172 16:1458408-1458430 GCCTGGCGCGGGTGACAGGCGGG + Intronic
1132770817 16:1562026-1562048 GACTGTGGGAGGTGGCAGGCCGG + Exonic
1132783340 16:1640894-1640916 GCCTGAGGAGGGGGCCAGGCAGG + Intronic
1133350740 16:5098592-5098614 ACCTGTGGAGGGTTTGAGGCAGG + Intergenic
1134253454 16:12591589-12591611 GCCTGTGGTGGGGGTGGGGGAGG + Intergenic
1136955962 16:34787123-34787145 GTCTGTGGGGTGTGTCAGGTAGG - Intergenic
1137394071 16:48104773-48104795 TGCTGTGGTGGGTGGCAGCCAGG - Intronic
1137719966 16:50622082-50622104 GCCTGTGGGGGATCTCAGGTGGG + Intronic
1138392005 16:56676815-56676837 GCCTGAGGTGGATGGGAGGCAGG + Intronic
1138440431 16:57031338-57031360 GCCTGTGGTGGGTGATGTGCTGG + Intronic
1138804240 16:60075594-60075616 GCCTGTTGGGGGTGGGAGGCTGG - Intergenic
1138910546 16:61392531-61392553 GCATGTGGTGGGTGTGTGGGTGG - Intergenic
1139952136 16:70677641-70677663 GCCTGCAGTGGGTGTCAGAAGGG + Intronic
1140143071 16:72277949-72277971 GCCAGTGGTAAGTGTTAGGCTGG + Intergenic
1140338547 16:74135096-74135118 GCCTGTCGTGGGATTCAGGGAGG + Intergenic
1140374389 16:74433247-74433269 GGCTGGGGTGGGAGTGAGGCAGG - Intergenic
1140702801 16:77598067-77598089 GCTTGGGGTGGGGGTCAGGTTGG - Intergenic
1141677279 16:85524458-85524480 GGCTGTGGTGGTTGTCAGATGGG + Intergenic
1141833428 16:86522556-86522578 GTCTGTGGTGGGTGCCAGAGGGG + Intergenic
1141949936 16:87333803-87333825 GCCTGTGCTAGGTGTGGGGCTGG + Intronic
1142767318 17:2072171-2072193 GCCTCTGGTGGGGGTGAGGGGGG + Intronic
1142805119 17:2367459-2367481 CCCTGTGGTGGGTGGCAGGCGGG - Intronic
1142894288 17:2964199-2964221 GCCAGGGGTGGGGGTGAGGCTGG + Intronic
1143913030 17:10267563-10267585 GCCTGAGGTAGGTGTCTGGGTGG - Intergenic
1144137745 17:12314560-12314582 GCTGGTAGTGGGTCTCAGGCAGG + Intergenic
1144639742 17:16930855-16930877 GCCTATGGGGAGTGTCAGGTGGG - Intronic
1144826351 17:18107766-18107788 GGCTGTGGAGGGTGTCAGCTGGG - Exonic
1145007148 17:19344377-19344399 GCCTGCGGTGGGTGCCAAGATGG - Intronic
1145250781 17:21295831-21295853 GCATGAGGTGGGTGGCAGGCTGG + Intronic
1146456717 17:33014644-33014666 GGCTGTGGTGGGTGGGAGGCTGG + Intronic
1146623594 17:34419342-34419364 GCCAGGGGTAGGGGTCAGGCAGG - Intergenic
1146688792 17:34858902-34858924 GCCTGTGATGGGGTCCAGGCTGG - Intergenic
1146910280 17:36644117-36644139 GCCTTTGGTGGCTTTGAGGCCGG + Intergenic
1148247035 17:46039174-46039196 GCCTGTGGGTCCTGTCAGGCCGG + Exonic
1150541056 17:66099541-66099563 GCCTTTTGTGGTTGTCAGCCTGG - Intronic
1152713250 17:81885507-81885529 GCCTGTGGTGGAGGTGGGGCTGG - Intergenic
1152828198 17:82480603-82480625 GACTGTTGTGGGTCTGAGGCCGG - Intronic
1152948095 17:83209390-83209412 CCCTTTGGTGGGTGCCAAGCGGG - Intergenic
1153256270 18:3174658-3174680 CCTTGTGGTGGGTTTCAGTCTGG + Intronic
1155031841 18:21991537-21991559 GACTTTGATGGGTGGCAGGCTGG + Intergenic
1157072939 18:44431029-44431051 GCCTGTTGCGGGTGGGAGGCTGG - Intergenic
1158422165 18:57304752-57304774 GCCTGTGGTGGGAGTCAGGGTGG + Intergenic
1159371289 18:67530391-67530413 GCCTGTAGTGGGAGGGAGGCAGG + Intergenic
1160748835 19:724177-724199 GCGTGTGGTGGGTGCCTGGTGGG + Intronic
1160757926 19:767417-767439 GTCTGCGGTGTGTGGCAGGCTGG - Intergenic
1161589112 19:5120826-5120848 GCCCTTGGTGGGAGGCAGGCTGG - Intronic
1163131624 19:15276986-15277008 TTCTGTGGTGGGGGTCAGGCAGG + Intronic
1163628017 19:18402054-18402076 GCAGGTGGTGGGGGACAGGCAGG + Intergenic
1165832992 19:38738386-38738408 GTCTGGGGTGGGTGTGGGGCTGG - Intronic
1165951446 19:39475904-39475926 GCCTGTGGTGCATGTCAGGGTGG - Intronic
1166099825 19:40565402-40565424 CCCTGCAGTGGGTGGCAGGCAGG - Exonic
1166262012 19:41646747-41646769 GCGTGGGGTGGGTGGCAGCCTGG - Intronic
1166344270 19:42155686-42155708 GCCTGGGGTGGGTGTGAGGTGGG - Intronic
1166996343 19:46721392-46721414 GCCTCTGGTGGGTGAGGGGCTGG - Intronic
1168261307 19:55196609-55196631 GTCTGTGTTGGGTCTCGGGCCGG - Exonic
1168337081 19:55602899-55602921 GCCGGGGGTGTGGGTCAGGCCGG - Exonic
1168573355 19:57488357-57488379 GACTGGGGTGGGGGTGAGGCGGG + Intronic
1168574772 19:57500487-57500509 GACTGGGGTGGGGGTGAGGCGGG + Intronic
1202686630 1_KI270712v1_random:55532-55554 GCCTGGGCTGGCTGTCTGGCTGG + Intergenic
1202710704 1_KI270714v1_random:18041-18063 GCCTCTGGAGGGCGTCAGACAGG + Intergenic
925969028 2:9094155-9094177 GACTGTGGTGGGCGTGAGGTGGG - Intergenic
927110539 2:19861189-19861211 GGCTGGGGTGGGTGTGGGGCTGG - Intergenic
927486965 2:23495268-23495290 GCCTCTGTGGGCTGTCAGGCAGG + Intronic
927571824 2:24166876-24166898 GCCTGAGATGGGAGTGAGGCTGG + Intronic
929598964 2:43193195-43193217 TCCTGTGATGGGTGTCAGCCAGG + Intergenic
931693165 2:64852430-64852452 GCCTTTTGTGTGTGTCATGCTGG - Intergenic
932572097 2:72943476-72943498 GCCTGGGGTGGGTGTGAGCAGGG - Exonic
932597265 2:73101802-73101824 AGGGGTGGTGGGTGTCAGGCTGG - Intronic
932813643 2:74844525-74844547 GCCTGTGGTGGGTGTGATCTTGG + Intronic
933958890 2:87396470-87396492 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933960949 2:87407655-87407677 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933960981 2:87407794-87407816 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933961435 2:87409859-87409881 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933961467 2:87409998-87410020 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933962171 2:87413328-87413350 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933962203 2:87413467-87413489 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933963693 2:87419987-87420009 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933963725 2:87420126-87420148 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933964434 2:87423472-87423494 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933965006 2:87426079-87426101 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
933965038 2:87426218-87426240 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
933965180 2:87426879-87426901 GCCTGGGCTGGCTGTCTGGCAGG - Intergenic
934243261 2:90289560-90289582 GCCTGGGCTGGCTGTCTGGCTGG - Intergenic
934270113 2:91528017-91528039 GCCTGGGCTGGCTGTCTGGCTGG + Intergenic
934270145 2:91528156-91528178 GCCTGGGCTGGCTGTCTGGCTGG + Intergenic
934502761 2:94872665-94872687 GCCTGTAGTGGTTCTCAGGGAGG - Intronic
935203060 2:100874934-100874956 GACTGTGGTGGGCCTCATGCTGG + Intronic
935632016 2:105219837-105219859 GATTGTGGTGGATGTCAGGAGGG + Intergenic
935918074 2:107979460-107979482 GCCTGTGGTGGCTGGGGGGCTGG + Intergenic
936083211 2:109449249-109449271 GCCTGAGGCTGGTGGCAGGCAGG - Exonic
936619715 2:114082735-114082757 GCCTGTGTTGGGCTTCAGGGAGG - Intergenic
937305441 2:120867775-120867797 GGCTGTGCTGGGCCTCAGGCGGG + Intronic
938113702 2:128589371-128589393 GCCTGGGGTGGGTGACAGCACGG + Intergenic
938365132 2:130728014-130728036 GCCGGCGGTGGGTGTTGGGCAGG + Intergenic
938383266 2:130848374-130848396 GCCCGTGCTGGGTGCCAGGGAGG + Intronic
939046724 2:137258604-137258626 GCCTGTGGCGGGTGGGGGGCAGG - Intronic
942127423 2:172841148-172841170 GCCTGTGGAAGGTGTTTGGCTGG + Intronic
943369614 2:187001552-187001574 CCCTGTGGTGGGGGCCGGGCTGG + Intergenic
944584317 2:201160180-201160202 GCCTGTGGCTGGCATCAGGCAGG + Intronic
946427947 2:219609298-219609320 GCCTGTGGGAGGTGTCCGTCTGG + Intronic
947228133 2:227859460-227859482 CCTTCTGGTGGGTGTCAGCCTGG + Intergenic
947722998 2:232380585-232380607 TCCTGTGGTGACTGGCAGGCTGG - Intronic
947727348 2:232408666-232408688 TCCTGTGGTGACTGGCAGGCTGG - Intronic
948518760 2:238522641-238522663 GGCTCAGGTGGGTGTCAGCCTGG + Intergenic
948716553 2:239869267-239869289 GTCTGTGGTGTGTGTGAGGAGGG - Intergenic
1168800751 20:642257-642279 GCCTGTGGTGGGGGGCCAGCGGG + Intergenic
1171251960 20:23655762-23655784 TGCGGGGGTGGGTGTCAGGCTGG - Intergenic
1175944970 20:62554451-62554473 GGCTGTGGTGGGGGTGAGGCTGG + Intronic
1175961707 20:62640592-62640614 GTCTGAGGCGGGTCTCAGGCCGG + Intergenic
1176030276 20:63008275-63008297 GCGTGTGCTGGGGGTGAGGCCGG - Intergenic
1176065676 20:63193259-63193281 GCTTCTGGTGGGTTACAGGCTGG - Intergenic
1176549176 21:8214106-8214128 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1176557069 21:8258327-8258349 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1176568108 21:8397144-8397166 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1176576011 21:8441364-8441386 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1176965636 21:15208763-15208785 GCCTGTGGTCCGTGCCTGGCTGG - Intergenic
1178277472 21:31252067-31252089 GCCTGTGGTGGGTGAGTAGCTGG + Exonic
1179050222 21:37882660-37882682 AACTGTGGTGGGAGGCAGGCAGG + Intronic
1179573746 21:42294172-42294194 GCCTGTGGCAGGTGTGTGGCGGG - Intronic
1179575908 21:42308357-42308379 GCCTGGCGTGGATGTCATGCTGG - Intergenic
1179935818 21:44602772-44602794 TCCTGGGGTGGGGGTCACGCAGG - Intronic
1179961272 21:44768145-44768167 TCCTGGGGTGGGGGTCACGCAGG - Intergenic
1180614249 22:17117582-17117604 GCCTGGGCTGGGTGTGGGGCAGG - Exonic
1181002786 22:19995701-19995723 GCCAGTGAAGGGTGGCAGGCGGG + Intronic
1181028927 22:20140740-20140762 GCCTCTGCTGGGTGTGGGGCGGG + Intronic
1181078044 22:20394429-20394451 GGCTGAGGTGGGGTTCAGGCCGG - Intronic
1181285073 22:21746100-21746122 GGCTGAGGTAGGTGCCAGGCAGG + Intergenic
1181512212 22:23394116-23394138 GCCGGGGGTGGGTGCCAGGCTGG + Intergenic
1181573902 22:23782139-23782161 GTCTGTGGTAGGGGTCAAGCAGG + Intronic
1182319047 22:29466429-29466451 GCATGTGGTGGGGGGCAAGCTGG - Intergenic
1182467497 22:30526258-30526280 GCCTGGGGTTGAGGTCAGGCAGG + Intronic
1183675882 22:39298602-39298624 CACTGTGTTGGGGGTCAGGCAGG - Intergenic
1184164035 22:42717015-42717037 GCTTGTGGTGGGTGACAGTGCGG + Intronic
1184183331 22:42846312-42846334 GCCTGTGGCAGGTGACAGGCAGG + Intronic
1184544792 22:45160224-45160246 GACTGTGATGGTTGTTAGGCTGG - Intergenic
1184550553 22:45202275-45202297 GCCTTTGGTGGGGCACAGGCAGG - Intronic
1184566440 22:45294816-45294838 GCACATGGTGGGTGTGAGGCAGG - Intronic
1184779640 22:46640718-46640740 GCCAGTGGTGGGTTTCAACCAGG - Intronic
1184886849 22:47351862-47351884 GGCTGTGGTGGGTGCCAGAGGGG - Intergenic
1185239888 22:49736931-49736953 GCCTGGGGTGGGGGACAAGCTGG - Intergenic
1203254061 22_KI270733v1_random:130422-130444 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1203262117 22_KI270733v1_random:175501-175523 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
949871657 3:8594585-8594607 GCCTGTGGTAAGGGGCAGGCTGG - Intergenic
950419991 3:12892859-12892881 CCCTGTGGAGGTTGTCAGGGGGG - Intergenic
952051045 3:29385036-29385058 GCCTGTTGTGTGTGACAGGAAGG + Intronic
952092843 3:29911189-29911211 ACAAGTGTTGGGTGTCAGGCAGG + Intronic
952771522 3:37005897-37005919 GCCTGAGGTGGGAGTGAGGGTGG - Intronic
953876760 3:46671099-46671121 GCATGTGGTTGGGATCAGGCAGG - Intronic
953930198 3:47002194-47002216 GCCATTGGTGGGTGGCAGGGAGG - Exonic
954634802 3:52065612-52065634 GCCTGTGGCCGGAGTCAGGCTGG - Intergenic
954636210 3:52072127-52072149 GACTGTGCTGGGTGGCAGGATGG + Intergenic
954655734 3:52193094-52193116 GACGGTGGAGGGTGGCAGGCGGG - Intergenic
954689799 3:52389621-52389643 GCCTGTGGTGTGGTCCAGGCTGG + Intronic
954712768 3:52513195-52513217 GCGTGTGGTGGGGTTCAGGGTGG - Exonic
954747040 3:52793222-52793244 GCCTGTGCTTGGTGTCTGGCTGG - Intergenic
956966827 3:74471187-74471209 GCCTGTGCAGGGTGGGAGGCTGG + Intronic
957048341 3:75393594-75393616 ACCTTTTATGGGTGTCAGGCTGG - Intergenic
960734060 3:120758570-120758592 GCCTGTCGGGGGTGGGAGGCTGG - Intronic
960880682 3:122341834-122341856 GCCTATGGTGGGGGTGAGGGTGG - Exonic
960995456 3:123337334-123337356 TGTTGTGCTGGGTGTCAGGCAGG - Intronic
961314781 3:126026978-126027000 GGCTGTGGTGTGTGTTTGGCAGG - Intronic
961347095 3:126270365-126270387 GCCTGGGGAGGGTGCCAGGCTGG - Intergenic
961647001 3:128398004-128398026 CCCTGTGGAGGCTGTCAGCCTGG + Intronic
961807676 3:129501001-129501023 GGCAGTGGTGAGTGTCAGGCTGG + Intronic
962146450 3:132844816-132844838 GCCTGGGGTGGGCCTCAGGAGGG + Intergenic
963286366 3:143438242-143438264 GCCTGTCATGTGTGTCAGGGCGG + Intronic
963300063 3:143587549-143587571 GACAGTGGTGGGAGTCAGGCTGG + Intronic
965430862 3:168586642-168586664 GGGTGAGGTGGGTGGCAGGCTGG - Intergenic
968086445 3:195876043-195876065 TCCTGTGGTGGGTGGGAGCCAGG - Intronic
968329395 3:197852847-197852869 GCCTCTGGTGGGGGTCAGGGAGG - Intronic
968358632 3:198130049-198130071 GCCTGTCGGGGGTGGGAGGCTGG - Intergenic
968569650 4:1332879-1332901 CCCTGGGGTCGGTGTCATGCTGG + Intronic
968944714 4:3657574-3657596 GCCTGGGGTGGGGGAAAGGCAGG + Intergenic
969282390 4:6179471-6179493 GCCTGTAGGGGGTGTCAGGAAGG - Intronic
969331314 4:6474731-6474753 GCTTGTGGTGGGGGTGGGGCAGG - Intronic
969506935 4:7593963-7593985 CCCAGTGGAGGGTGTCAGGATGG - Intronic
969642121 4:8405222-8405244 GCCTGTGCTGGGATGCAGGCGGG - Intronic
972614630 4:40686254-40686276 GCTTGTGCTGGTTGCCAGGCTGG + Intergenic
973746886 4:53972085-53972107 GCCTGTGATGGGTTTCTGGGAGG + Intronic
979439356 4:120733313-120733335 GCATGAGGTGGGGGTCAGGCAGG - Intronic
980704492 4:136475172-136475194 GCCTCTGGTGGGGGTCCTGCAGG - Intergenic
981779514 4:148411130-148411152 GCCAGTGGTGGGTGGTGGGCGGG - Intronic
981794867 4:148584982-148585004 GCATCTGGTGGGTGTCCCGCTGG - Intergenic
982202417 4:152973585-152973607 GCCTGTGGTGGTGGTGGGGCCGG - Intronic
982753779 4:159194245-159194267 GCCTGTGGTGTGGGTCAGGGTGG + Intronic
983015001 4:162602726-162602748 ACCAGTGGTGGGTGTCATGAGGG + Intergenic
983577379 4:169273098-169273120 GGGTGTGGTGGGTGCCAGCCTGG - Intergenic
984227803 4:177055879-177055901 TCCTGGGGTGGGGGTCAGGGAGG + Intergenic
984972091 4:185200673-185200695 GCCTGTAGAGGCTGTGAGGCAGG + Intronic
985186599 4:187323949-187323971 GCCTCTGGTATGGGTCAGGCAGG - Intergenic
985843164 5:2324776-2324798 AGTTGTGGTGGGTGTCAGGGAGG + Intergenic
987075683 5:14379951-14379973 GCCTGGGGTGGGTGGCCAGCAGG - Intronic
988334264 5:29885366-29885388 GTGTGTGGTGGGTGTCATGGTGG + Intergenic
998004019 5:138645266-138645288 GCCTGGGGTGGGGGTAAGGAGGG + Intronic
998566860 5:143223554-143223576 GCCAGTGGTGGGTTAGAGGCAGG - Exonic
999229342 5:150052498-150052520 GCCTGCGGTGTGGGTCAGGGTGG + Exonic
1001115316 5:168934503-168934525 GCCTTCTGTGGATGTCAGGCTGG + Intronic
1002182997 5:177441193-177441215 GCCAGGGGTGGGGGACAGGCGGG - Intronic
1002742262 5:181442545-181442567 CCCTTTGGTGGGTGCCAAGCGGG - Intergenic
1004731816 6:18366423-18366445 TCCTGGGGTGGGGGCCAGGCTGG + Intergenic
1005922643 6:30415752-30415774 CCCTGGGGTGGGTGTTAGGCAGG + Intergenic
1006059804 6:31411595-31411617 GCCTGTGGTGGGTGTCAGGCAGG + Intronic
1006072294 6:31506666-31506688 GCCTGGTGTGGGAGTTAGGCAGG + Intronic
1006147801 6:31969631-31969653 GCCTGTGCTGGGTGCCAAGATGG + Exonic
1006448175 6:34091442-34091464 GTCTGTGGTGGGGGTGAGGGTGG - Intronic
1007131236 6:39476040-39476062 GCCTGTGGTGGGGGTGGGGAAGG + Intronic
1007613270 6:43164502-43164524 GGCTGTGCTTGGTGCCAGGCTGG + Intergenic
1007698190 6:43747157-43747179 GCCTGTGATGGGGGTGAGGGGGG - Intergenic
1007924179 6:45638066-45638088 GCTTGTGGTGAGTGACAGGCAGG + Intronic
1008137072 6:47789149-47789171 GCTTGAGGTGGGTGTCAGCCAGG - Intronic
1008542573 6:52558089-52558111 GCCTGAGGTGGGGGTAGGGCAGG - Intronic
1011159287 6:84370172-84370194 GCCTGTGGGGGAAGTAAGGCAGG + Intergenic
1012791140 6:103697642-103697664 GGCTGGGGTGGGTGGGAGGCGGG - Intergenic
1017751409 6:157493005-157493027 GCCTCTGGAGGGTTTGAGGCAGG + Intronic
1018014022 6:159695971-159695993 TACTGTGGTGGGTCTCAGGATGG - Intronic
1019071825 6:169353253-169353275 GCATTTGGTGGGTGTCCTGCTGG - Intergenic
1019247398 6:170718283-170718305 CCCTTTGGTGGGTGCCAAGCGGG - Intergenic
1019511170 7:1418335-1418357 GCCTTTGGAGAGTATCAGGCAGG - Intergenic
1023634131 7:42192935-42192957 GCCTGTGGTCTGTGCAAGGCTGG - Intronic
1024026163 7:45411696-45411718 GCTTGTGGTGTGTGTCTGCCTGG + Intergenic
1024262187 7:47581391-47581413 CCCTTTGGTGGGTGGGAGGCAGG - Intronic
1025205244 7:56989265-56989287 GTCAGTGGTGGGAGACAGGCAGG - Intergenic
1025666694 7:63587669-63587691 GTCAGTGGTGGGAGACAGGCAGG + Intergenic
1026892898 7:73992701-73992723 CCCTGTTGTGGGTGTGTGGCTGG + Intergenic
1029108192 7:98195296-98195318 CCCTGCGGTGGGTGTCTGGAGGG + Intronic
1030304642 7:108005520-108005542 GCCTGTAAGGGGTGTGAGGCGGG + Intergenic
1032018159 7:128392693-128392715 CCCTGGGGTGGGGGCCAGGCTGG + Exonic
1033097304 7:138442515-138442537 CCCTGGGGTGGGGGCCAGGCTGG - Intergenic
1033469609 7:141633063-141633085 GGCTGTGGTGGGAATCAAGCTGG + Intronic
1034132511 7:148733083-148733105 GCCAGTGGTGGTGGTGAGGCGGG + Intronic
1035048344 7:155983668-155983690 GTCTGTGGTGGGTGACAAGTAGG + Intergenic
1035267687 7:157700691-157700713 GCCTCTGATGGGTGTGAGGAAGG - Intronic
1035500739 8:89653-89675 CCCTTTGGTGGGTGCCAAGCGGG + Intergenic
1035720051 8:1784932-1784954 GCCTCTGGTGGGGGCCAGCCTGG + Exonic
1036643628 8:10599153-10599175 GCCGGTGGAGGGTGTCAGGTCGG + Intergenic
1036682762 8:10887605-10887627 GCCTGTCCTGGGTTTTAGGCAGG + Intergenic
1037154116 8:15678290-15678312 GCTGGTGGTGGAAGTCAGGCTGG + Intronic
1037494418 8:19424879-19424901 GACTGTAGTGGTTGCCAGGCAGG + Intronic
1037825044 8:22155871-22155893 GGCTGTTGTGAGTGACAGGCTGG + Intronic
1038190509 8:25315481-25315503 GCGTGTGCTGGGTGTCTGGGTGG - Intronic
1040448803 8:47523615-47523637 GCTGGTGATGGGGGTCAGGCTGG + Intronic
1041986691 8:63930498-63930520 GCCCTAGGTGGGTCTCAGGCAGG - Intergenic
1044512516 8:93098744-93098766 GCCTGGGGTGGGGGTAGGGCAGG + Intergenic
1044760068 8:95508566-95508588 GCCTGTGGTGGGGAGGAGGCAGG - Intergenic
1046148086 8:110188378-110188400 GCCTGTTGTGGGTTTGAGGGAGG + Intergenic
1048451486 8:134537599-134537621 GCCCCTGGTAGGTGTCAGGTGGG + Intronic
1049255075 8:141609336-141609358 GCCTGGGGTGGGTGACGGCCGGG + Intergenic
1049793013 8:144481280-144481302 GCCTGGGCTGGGTGTGAGGAAGG - Intronic
1050308054 9:4326046-4326068 GCCTGTCGGGGGTGGCAGGGAGG + Intronic
1051523127 9:18012658-18012680 GTCTGTGGTGGGTATTAGGAAGG + Intergenic
1052860819 9:33436830-33436852 GGCTGTGGAGGGTGCCAGGAGGG - Intergenic
1057798626 9:98175583-98175605 GCCTCTGGAAGGTGACAGGCAGG - Intronic
1057898395 9:98927963-98927985 GCCTGGGGAGGCTGGCAGGCTGG - Intergenic
1060530360 9:124344109-124344131 GCCTCTGGTGTGCGTCAGCCTGG + Intronic
1061280898 9:129597286-129597308 CCCTGGGGAGGGCGTCAGGCGGG + Intergenic
1061922353 9:133789036-133789058 GCCTGTGGCGGGCACCAGGCTGG - Intronic
1061922718 9:133791001-133791023 GTGTCTGGTGGGTGGCAGGCAGG + Intronic
1061958824 9:133977726-133977748 GTCTGTGGTTGGCGTCCGGCAGG - Intronic
1062171811 9:135138875-135138897 GCCAGTGATGGGGTTCAGGCAGG + Intergenic
1062532762 9:137009120-137009142 GCCTGTGGGGGCTGTAGGGCTGG - Intronic
1203470462 Un_GL000220v1:113566-113588 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1203478283 Un_GL000220v1:157538-157560 GCCCGTGGACGGTGTGAGGCCGG + Intergenic
1203608171 Un_KI270748v1:73760-73782 CCCTTTGGTGGGTGCCAAGCGGG - Intergenic
1187729582 X:22238842-22238864 CGCTGTGCTGGCTGTCAGGCAGG - Intronic
1189193615 X:39133342-39133364 GCCTGAGGTGGGGGCCAGGAGGG + Intergenic
1191049047 X:56171521-56171543 GCCTGTTGTGGGGTTCAGGGAGG - Intergenic
1195752097 X:108169705-108169727 GCCTCTGGTGTCTGTCAGTCAGG - Intronic
1198002184 X:132451049-132451071 GCATCTGGTGGGTGTCACTCCGG - Intronic
1198342907 X:135732419-135732441 GGCTGGGGTGGGGCTCAGGCAGG - Intergenic
1198345082 X:135750876-135750898 GGCTGGGGTGGGGCTCAGGCAGG + Intergenic
1199165057 X:144662528-144662550 GCCTGTGAAGGGTGTAAGGAGGG - Intergenic
1199703523 X:150404108-150404130 GCCTGTGGTGGCTCTCAGAAGGG - Intronic
1200127367 X:153822334-153822356 GCCTGAGGTGGGTGGGAGGATGG - Intronic
1200747950 Y:6918906-6918928 GTCTCTTGTGGGTCTCAGGCTGG + Intronic
1201405227 Y:13643114-13643136 GCCTTTGGTGGGACACAGGCTGG + Intergenic