ID: 1006059805

View in Genome Browser
Species Human (GRCh38)
Location 6:31411596-31411618
Sequence TCCTGCCTGACACCCACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059805_1006059808 -7 Left 1006059805 6:31411596-31411618 CCTGTGGTGGGTGTCAGGCAGGA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1006059808 6:31411612-31411634 GGCAGGAGAGGAAGCCTTCAGGG 0: 1
1: 2
2: 2
3: 56
4: 400
1006059805_1006059809 -2 Left 1006059805 6:31411596-31411618 CCTGTGGTGGGTGTCAGGCAGGA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1006059809 6:31411617-31411639 GAGAGGAAGCCTTCAGGGCCAGG No data
1006059805_1006059810 -1 Left 1006059805 6:31411596-31411618 CCTGTGGTGGGTGTCAGGCAGGA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059805_1006059807 -8 Left 1006059805 6:31411596-31411618 CCTGTGGTGGGTGTCAGGCAGGA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1006059807 6:31411611-31411633 AGGCAGGAGAGGAAGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059805 Original CRISPR TCCTGCCTGACACCCACCAC AGG (reversed) Intronic
900547003 1:3234832-3234854 TGGTGCCTGACACCCACCTTTGG + Intronic
900599801 1:3498108-3498130 TCCTCCGTTCCACCCACCACAGG + Intronic
901532365 1:9861575-9861597 TCCAGGCTGACAACCACCACAGG + Intronic
902341555 1:15786719-15786741 TCCTGCCTCATGCCCAGCACTGG + Intergenic
902545343 1:17186311-17186333 TTCTCCCAGACACCCAGCACAGG - Intergenic
902928890 1:19716594-19716616 ACCTGTCTGACACCCACACCAGG - Intronic
903017332 1:20369424-20369446 CCCTGCCTCACCCCCACCAGGGG + Intergenic
903978360 1:27166991-27167013 CCCTGCCAGACCCCCACCTCGGG + Intergenic
904982037 1:34513329-34513351 TCCTCCCTGCAACCCACAACAGG + Intergenic
906723772 1:48028640-48028662 GCCCGCCTCAGACCCACCACCGG + Intergenic
907390394 1:54154310-54154332 TCCTGCCAGTCAACCTCCACAGG - Intronic
907499998 1:54871984-54872006 CACTGCCTGACACCCACTAAAGG - Intronic
909172931 1:72317921-72317943 TCTTGCCTGACAACCGCCTCAGG + Intergenic
910463292 1:87470671-87470693 GCCTGCCAGACCCCCAGCACAGG - Intergenic
910596267 1:88983913-88983935 TCCTAACTGACAGCCGCCACTGG - Exonic
914470982 1:147978430-147978452 TCCTGACTGAGACCCACCAGGGG - Intronic
915318278 1:155041916-155041938 TCCTGCCTGTCACCTACCAGTGG - Intronic
915676210 1:157534578-157534600 TCTTGCCAGTCACCCACCCCTGG - Intronic
915676745 1:157539050-157539072 TCCTGCCAATCACCCACCCCTGG - Intronic
915677201 1:157542823-157542845 TCCTGCCAATCACCCACCCCTGG - Intronic
915686088 1:157636260-157636282 TCCTGCCAGTCACCCACCCCTGG - Intergenic
916031841 1:160883728-160883750 TCCGACCTGACAGCCAGCACAGG + Intronic
916623511 1:166527567-166527589 TTCAGCCTGACACCCATCCCTGG + Intergenic
920091299 1:203455147-203455169 TCCTGCCCCAAACCCACCAAGGG + Intergenic
920529523 1:206691744-206691766 TCCTGCCTGCCCTCCACCTCTGG - Intronic
922526422 1:226308335-226308357 CCCTGCCTGACACCCACCCTAGG - Intronic
1062802617 10:391319-391341 CCCTGCCTGGCACCCATGACAGG - Intronic
1062958021 10:1552797-1552819 TCCTGCCGGACACTCACCCCTGG + Intronic
1063225818 10:4013738-4013760 TCCTGCCTCACACCCGCCCACGG - Intergenic
1064032423 10:11891342-11891364 TGCTGCCACACACCCACCAGGGG - Intergenic
1064932253 10:20640754-20640776 TCCTCCCTGACAACCTCCTCAGG - Intergenic
1067558639 10:47289241-47289263 TCCTGGCTGAAACCCTCCCCAGG - Intergenic
1067575133 10:47404113-47404135 CCCTGTCTGAGACCCACCAGGGG - Intergenic
1067704803 10:48598762-48598784 TCCTGCATTGCAGCCACCACAGG + Intronic
1069192635 10:65508822-65508844 TCCTGCCTGGCACCTGCCTCAGG + Intergenic
1070559925 10:77558601-77558623 TTCCCCTTGACACCCACCACAGG - Intronic
1070560794 10:77565158-77565180 TCCTGCCTTGCACCCAGCACTGG + Intronic
1070714164 10:78706617-78706639 TCTTGCCTGACCCCTACCCCTGG - Intergenic
1073161937 10:101405529-101405551 TGCTGCCTGAAACCCACAAGTGG - Intronic
1073477131 10:103761715-103761737 TTCTGCCTGAGACAGACCACTGG - Intronic
1076709288 10:132322743-132322765 TCCTGCCTGACACCCATTTGGGG + Intronic
1076824051 10:132958340-132958362 TCCTGCCTGCCCCACACCCCAGG - Intergenic
1077114206 11:875840-875862 TCCTGTCTGTCACCCGCCAGGGG - Intronic
1079633633 11:22708938-22708960 TCCATCCTGCCTCCCACCACAGG - Intronic
1080765154 11:35289178-35289200 TCCTCCCTGACACCAGCCTCTGG + Intronic
1081754925 11:45537650-45537672 CCCTGCCTGACCCCCACTCCTGG - Intergenic
1083311540 11:61786369-61786391 TCCTGCCTGCCACCCCCTAGGGG + Exonic
1083618209 11:64036508-64036530 ACCGGCCTGACGCCCCCCACGGG - Intronic
1083946300 11:65924914-65924936 TCCTGCCTCCCATCAACCACGGG - Intergenic
1084308303 11:68300652-68300674 GCCTCCCTCAGACCCACCACAGG + Intergenic
1084680160 11:70662304-70662326 TCCTGCCTGCCGCACACCGCCGG - Intronic
1085791768 11:79502806-79502828 TCCTACCAGCCACCCATCACTGG - Intergenic
1087380550 11:97399357-97399379 TCCTGGCTGACACCCACCTACGG - Intergenic
1088817946 11:113434154-113434176 TCCTCGGTGACACCCAGCACAGG + Intronic
1090435778 11:126685302-126685324 GCCTGCCTCACACCCAGCACTGG + Intronic
1090584872 11:128200579-128200601 CCCTGCCAAACACCAACCACAGG - Intergenic
1091232285 11:133996505-133996527 TCCTGCCTGACTCCCGCAACAGG + Intergenic
1091350437 11:134889905-134889927 TCCTCCCTGACCCACCCCACAGG - Intergenic
1092703055 12:11254571-11254593 TTGTGCTTCACACCCACCACAGG + Intergenic
1094856239 12:34404131-34404153 TCCTGGCTCACACCCACAAAGGG + Intergenic
1096302634 12:50444996-50445018 TCTTGCCTCGCACCCACCCCCGG + Intronic
1098673972 12:73266138-73266160 TCCAGCCAGCCACCCACAACAGG + Intergenic
1101889885 12:108703777-108703799 GCCTGGATGACACCCAGCACAGG + Intronic
1102505307 12:113380947-113380969 TCCTACATGGCACCCAGCACTGG - Intronic
1103129867 12:118458796-118458818 TCCTCCCTGACCCCCACCAAAGG + Intergenic
1106242340 13:27921650-27921672 CCCTGCCTGACACTGACCCCAGG + Intronic
1106475124 13:30091851-30091873 TCCTGCCTGTCACTGGCCACTGG + Intergenic
1108432548 13:50368657-50368679 TCCTGGAGGACACCCACCATGGG - Intronic
1113035113 13:106039637-106039659 TCCAGCCTAACACACACAACTGG + Intergenic
1113088812 13:106595888-106595910 TCCTGCCTCACTCCTTCCACTGG - Intergenic
1116547442 14:46186559-46186581 TCCAGCCTCACCCCCGCCACAGG + Intergenic
1119472152 14:74906939-74906961 CCTTGCCTGACACCCAACCCAGG - Exonic
1120722506 14:87904234-87904256 GCCTGCCACACACCCATCACTGG + Intronic
1121121365 14:91377770-91377792 TGGTCCCTGACACCCAGCACTGG - Intronic
1121231919 14:92364619-92364641 GCCTCCCTCCCACCCACCACGGG - Intronic
1121767845 14:96502708-96502730 TCCTGCCTGCCTCCTACCAGCGG - Intronic
1122070315 14:99201684-99201706 TCCTTGCTCACACCCAGCACTGG + Intronic
1123811856 15:23935011-23935033 TCATGCCTCACATCCAACACTGG - Intergenic
1123997660 15:25729946-25729968 TCCTTCCTGTCATCCCCCACTGG - Intronic
1125677084 15:41507943-41507965 CCCTGCCCAGCACCCACCACAGG + Intronic
1126092206 15:45062470-45062492 TCCTGGCTGAAAACCACCACTGG - Intronic
1126112242 15:45182164-45182186 ACATCCCTGACCCCCACCACGGG + Intronic
1127632462 15:60839994-60840016 CCCTGCCTGCTACCCACAACAGG - Intronic
1130898929 15:88192549-88192571 TCCTGCCTAAAACCCTCCAATGG + Intronic
1131046764 15:89321610-89321632 TCCTGCCTGACCCAGATCACAGG + Intronic
1131158498 15:90089595-90089617 TCATGCCTGACCCACAGCACTGG - Intronic
1132292472 15:100713235-100713257 TCCTGCCTGTCCCCCACGGCTGG + Intergenic
1132665731 16:1080582-1080604 TGCTGCCCGACACCCCCCATGGG + Intergenic
1133350741 16:5098593-5098615 GCCTGCCTCAAACCCTCCACAGG - Intergenic
1133819453 16:9223640-9223662 TCCAGCCTGAAAGCCAGCACTGG + Intergenic
1134103300 16:11468063-11468085 TCCTCCCTGACAGCCTTCACAGG + Intronic
1134655627 16:15946592-15946614 CCCTGCCTAAAACCCACCAGTGG + Intergenic
1134827572 16:17296824-17296846 TCCAGACTGACACAAACCACCGG + Intronic
1136548154 16:30966810-30966832 TCCTGCCTGAGACCTACTCCCGG - Intronic
1139548769 16:67662055-67662077 TACTGCCTGAGACCCACCGACGG + Exonic
1140143072 16:72277950-72277972 TCCAGCCTAACACTTACCACTGG - Intergenic
1140338548 16:74135097-74135119 TCCTCCCTGAATCCCACGACAGG - Intergenic
1141648839 16:85381880-85381902 CCCTGCCTGACACCCGCCTGGGG + Intergenic
1142147235 16:88497729-88497751 TCCTGCCTGAGGCCCACGAAGGG + Intronic
1142285551 16:89170095-89170117 ACCTGCCTCCCACCCACCTCGGG - Intergenic
1142473800 17:178449-178471 TCCTGCCCGGCACCCACCTGTGG - Intronic
1142805118 17:2367458-2367480 GCCCGCCTGCCACCCACCACAGG + Intronic
1143112443 17:4560022-4560044 TCCTGCCTGCCACACCCCACTGG - Intronic
1146623593 17:34419341-34419363 TCCTGCCTGACCCCTACCCCTGG + Intergenic
1148902379 17:50888115-50888137 TCCTGCCTGATCCCCACCTCTGG - Intergenic
1151848987 17:76678584-76678606 TCCTGCCCCCCACACACCACGGG + Intronic
1151925503 17:77192950-77192972 TCATGCCTGACCCCCATCCCTGG + Intronic
1153226159 18:2901570-2901592 GCCTGCCTGACACTCCGCACGGG - Intronic
1154263031 18:12854541-12854563 TCCTCCCTGACACACTTCACTGG - Intronic
1158422166 18:57304753-57304775 TCCACCCTGACTCCCACCACAGG - Intergenic
1158513819 18:58114601-58114623 TCCTGCCTTACAGCAGCCACAGG - Intronic
1160160491 18:76466680-76466702 TCTTGCCTCACACCCATCCCAGG - Intronic
1160858090 19:1226372-1226394 ACCTGGCTGGCCCCCACCACGGG - Intronic
1162311068 19:9907537-9907559 TCCTTCCTAACATCCAACACAGG + Intronic
1163813145 19:19447244-19447266 TCCTGGCTCACTCCCACCTCAGG - Intronic
1165951445 19:39475903-39475925 TCCACCCTGACATGCACCACAGG + Intronic
1166099824 19:40565401-40565423 CCCTGCCTGCCACCCACTGCAGG + Exonic
1168067350 19:53925654-53925676 TCCTGCCTGAGCCCTTCCACTGG - Intronic
927866538 2:26591517-26591539 TCCTGCCTCACTTCCACCATGGG + Intronic
927917474 2:26946232-26946254 TCCTGCCTGAGAGCCAAGACTGG + Intronic
928305356 2:30165761-30165783 TACTGCCTGACACACATAACAGG - Intergenic
929598965 2:43193196-43193218 GCCTGGCTGACACCCATCACAGG - Intergenic
932774442 2:74519110-74519132 TCCTGCCAGACCCCCACCATGGG - Exonic
937379727 2:121365655-121365677 TCCTGAGTCAGACCCACCACTGG + Intronic
938365133 2:130728015-130728037 CCCTGCCCAACACCCACCGCCGG - Intergenic
938383267 2:130848375-130848397 ACCTCCCTGGCACCCAGCACGGG - Intronic
941298224 2:163767371-163767393 TGCTGCCTGAATCCTACCACTGG - Intergenic
941326152 2:164117048-164117070 TGCTGCCTGATACCAGCCACAGG + Intergenic
941951615 2:171161273-171161295 TCCTGACCCACACCCAACACGGG + Intronic
943037242 2:182762406-182762428 TTCTTCCTGCCACCCACTACTGG - Intronic
943369615 2:187001553-187001575 TCCAGCCCGGCCCCCACCACAGG - Intergenic
943618110 2:190116717-190116739 TCCTGCCTCACACCCAACTCTGG - Intronic
944584318 2:201160181-201160203 TCCTGCCTGATGCCAGCCACAGG - Intronic
945656944 2:212635533-212635555 TCCTCCCCCATACCCACCACTGG - Intergenic
947499967 2:230664655-230664677 TACTGCCTGCCCCCCACCTCAGG + Intergenic
1170550130 20:17469400-17469422 TTCTCCCTGACACCCAGCATGGG - Intronic
1174113733 20:48213327-48213349 TGCACCCTGACACCCACCACAGG - Intergenic
1176073044 20:63236608-63236630 TCGTGCCTGACACCCTCCCCCGG + Intronic
1176870194 21:14077869-14077891 TTCTGCCTCACACACACCCCAGG - Intergenic
1179112663 21:38460793-38460815 TACAGCCTCACACCCATCACCGG - Intronic
1179935817 21:44602771-44602793 TCCTGCGTGACCCCCACCCCAGG + Intronic
1179961271 21:44768144-44768166 TCCTGCGTGACCCCCACCCCAGG + Intergenic
1180069975 21:45431353-45431375 TCCTGCCTGCCCCCCTCCCCTGG - Intronic
1180069991 21:45431385-45431407 TCCTGCCTGCCCCCCTCCCCTGG - Intronic
1180070021 21:45431449-45431471 TCCTGCCTGCCCCCCTCCCCTGG - Intronic
1180070052 21:45431512-45431534 TCCTGCCTGCCCCCCTCCCCTGG - Intronic
1180070066 21:45431544-45431566 TCCTGCCTGCCCCCCTCCCCTGG - Intronic
1181512213 22:23394117-23394139 CCCAGCCTGGCACCCACCCCCGG - Intergenic
1184183332 22:42846313-42846335 GCCTGCCTGTCACCTGCCACAGG - Intronic
1184550552 22:45202274-45202296 TCCTGCCTGTGCCCCACCAAAGG + Intronic
1184590846 22:45482247-45482269 GGCTGCCTGACAGCCACCCCTGG + Intergenic
1184779639 22:46640717-46640739 CCCTGGTTGAAACCCACCACTGG + Intronic
1184904953 22:47476079-47476101 TCCTCCCTTCCACCTACCACTGG + Intronic
950489389 3:13294476-13294498 CTTTGCCTGACACCCACCAGTGG + Intergenic
950789381 3:15460461-15460483 TACTGCCTGACACCAATGACTGG - Intronic
952899780 3:38102334-38102356 TCCTCCCTGTCACCCAGCAGGGG - Intronic
953031085 3:39180470-39180492 TCCTGCATAATACCCTCCACCGG - Intergenic
953930197 3:47002193-47002215 CCCTCCCTGCCACCCACCAATGG + Exonic
956121620 3:65971753-65971775 TCCTGCCTGACACACTTCCCTGG + Intronic
960174089 3:114496912-114496934 TCCTCCCTCACACCCACTATGGG + Intronic
960684427 3:120282828-120282850 TCCTGCTTAACACCCTCCAATGG - Intronic
961347094 3:126270364-126270386 TCCAGCCTGGCACCCTCCCCAGG + Intergenic
961486171 3:127218351-127218373 ACCTCCCTCACAGCCACCACCGG + Intergenic
961501307 3:127337992-127338014 CCCTCCTTGACACCCGCCACGGG - Intergenic
961647002 3:128398005-128398027 TCCAGGCTGACAGCCTCCACAGG - Intronic
961824918 3:129594053-129594075 TCCTGCCGCAGACCCACCGCAGG + Intronic
965216971 3:165875312-165875334 TCCTGCCTGCCTGGCACCACAGG - Intergenic
965670262 3:171140550-171140572 GGCTCCCTGACACCCCCCACCGG - Intronic
968086444 3:195876042-195876064 GCCTGGCTCCCACCCACCACAGG + Intronic
968329394 3:197852846-197852868 CCCTCCCTGACCCCCACCAGAGG + Intronic
968511625 4:998175-998197 TCCTGCTGGACACCCAGCCCGGG + Intronic
968699130 4:2046604-2046626 TCCTCCCTGCCACCCCACACTGG + Intergenic
969282389 4:6179470-6179492 ACCTTCCTGACACCCCCTACAGG + Intronic
969506934 4:7593962-7593984 TCCATCCTGACACCCTCCACTGG + Intronic
969638337 4:8382224-8382246 TCCTGCCTGACACCCCACCCCGG - Intronic
970274761 4:14386385-14386407 TGCTGCCTGACTCCCTCCAGTGG - Intergenic
971822105 4:31570959-31570981 TCCTACCTGATATCCATCACTGG + Intergenic
972412111 4:38805887-38805909 TCCTCCCTGAGACCCATAACTGG + Intronic
976046736 4:80957241-80957263 TACTGCCTGAAACCCATTACTGG - Intronic
977292670 4:95180724-95180746 TCCCTCCAGCCACCCACCACCGG - Intronic
979322036 4:119336003-119336025 TCCTGCTTAACACTCTCCACTGG - Intergenic
980126377 4:128778427-128778449 TCCTGCCTCAGCCCCACGACTGG - Intergenic
983015002 4:162602727-162602749 ACCCTCATGACACCCACCACTGG - Intergenic
984227804 4:177055880-177055902 CCCTCCCTGACCCCCACCCCAGG - Intergenic
984972092 4:185200674-185200696 TCCTGCCTCACAGCCTCTACAGG - Intronic
986182197 5:5403607-5403629 TACTGCCTCACTCCCAGCACAGG - Intergenic
986722184 5:10567180-10567202 TCCTGCCTCGCTCCCCCCACTGG - Intronic
991635180 5:68697498-68697520 TCCTCCCTGCCCCCCACCCCTGG - Intergenic
993708967 5:91203846-91203868 TCCTGCCTGGCACCCACACACGG - Intergenic
995417543 5:111926911-111926933 TCCTGCCTGACCCACTCCTCCGG - Intronic
998566859 5:143223553-143223575 GCCTGCCTCTAACCCACCACTGG + Exonic
999177892 5:149644611-149644633 TCATCTCTGACACCCAGCACAGG + Intergenic
999722047 5:154405525-154405547 TCCTGCCTGGCTCCCTCCTCAGG - Intronic
999777645 5:154823718-154823740 TCCTGACTGCCACCCAGCTCTGG + Intronic
1002182996 5:177441192-177441214 TCCCGCCTGTCCCCCACCCCTGG + Intronic
1003167806 6:3696704-3696726 ACCTGCCACACACCCAGCACTGG + Intergenic
1004582205 6:16965168-16965190 TCCTCCCTAACACCCAGGACCGG - Intergenic
1004731817 6:18366424-18366446 TCCAGCCTGGCCCCCACCCCAGG - Intergenic
1004988602 6:21111500-21111522 TCCTGCCTGACCCCAGACACAGG + Intronic
1005198800 6:23319525-23319547 TGATGCCTGTCACCCACCAGGGG + Intergenic
1005260382 6:24052645-24052667 TCTTGCCTGGCAACCAACACAGG + Intergenic
1005708214 6:28478308-28478330 TCCTGCCGGACACCCAATTCTGG - Intergenic
1005841064 6:29744888-29744910 TCCTGCCTAATGCCCACCCCAGG + Intergenic
1005922644 6:30415753-30415775 TCCTGCCTAACACCCACCCCAGG - Intergenic
1006059805 6:31411596-31411618 TCCTGCCTGACACCCACCACAGG - Intronic
1006072295 6:31506667-31506689 TCCTGCCTAACTCCCACACCAGG - Intronic
1007131237 6:39476041-39476063 TCCTTCCCCACCCCCACCACAGG - Intronic
1007239237 6:40413367-40413389 GCCTGCCTGCCACTCAGCACTGG + Intronic
1008542572 6:52558088-52558110 TCCTGCCCTACCCCCACCTCAGG + Intronic
1017448023 6:154526843-154526865 TCCTGCCTCAGCCTCACCACAGG - Intergenic
1019344915 7:524866-524888 TCCTGCCTGAGGCCCTCCAACGG - Intergenic
1019916308 7:4134939-4134961 CTCTGCCTGACACCCACTTCAGG + Intronic
1022190867 7:28015921-28015943 TCTCCCCTCACACCCACCACAGG + Intronic
1022254204 7:28639854-28639876 TCCTGCCTGAAATTCACAACTGG + Intronic
1023872878 7:44272213-44272235 TCCTGCCTCAGACCTACCACTGG - Intronic
1024169242 7:46766981-46767003 TCCTGCATAACCCCCACCTCAGG - Intergenic
1024262186 7:47581390-47581412 CCCTGCCTCCCACCCACCAAAGG + Intronic
1024329832 7:48144741-48144763 TCCTGCCTCACAACCACCCTGGG + Intergenic
1026892899 7:73992702-73992724 TCCAGCCACACACCCACAACAGG - Intergenic
1027235952 7:76297894-76297916 TCCTGTCTGCCTCCCACCATTGG + Intergenic
1030139885 7:106293519-106293541 TCCTGCTGTGCACCCACCACAGG - Intergenic
1032018160 7:128392694-128392716 TCCAGCCTGGCCCCCACCCCAGG - Exonic
1032186075 7:129727791-129727813 TGCTGCCTGACCCCAAGCACAGG - Intronic
1033097303 7:138442514-138442536 TCCAGCCTGGCCCCCACCCCAGG + Intergenic
1033500762 7:141946717-141946739 TCCTGTCTGTCACCTACCCCTGG - Intronic
1035715174 8:1748527-1748549 TCCAGCCAGACACCGACCTCGGG - Intergenic
1036643629 8:10599154-10599176 CCCGACCTGACACCCTCCACCGG - Intergenic
1037535813 8:19823116-19823138 TCCTCCCTGACTCCAGCCACTGG + Intronic
1037674209 8:21040307-21040329 TCCTGCCTGGTTCCCGCCACAGG - Intergenic
1037719164 8:21428257-21428279 TCCTGCCTGTTAGCCACCACTGG - Intergenic
1038037983 8:23702537-23702559 TCCTGCGCCACACACACCACTGG - Exonic
1039337478 8:36607923-36607945 TCCTACCTGATACCCACTTCTGG + Intergenic
1039400975 8:37268988-37269010 AGCAGCCTGACCCCCACCACTGG - Intergenic
1039922893 8:41905743-41905765 TCCTGCCTTAAAGCCAGCACAGG + Intergenic
1040982091 8:53254359-53254381 TCCTGCCTGAGAGCCTTCACTGG - Intergenic
1041986690 8:63930497-63930519 CCCTGCCTGAGACCCACCTAGGG + Intergenic
1045676638 8:104614863-104614885 TCCCCACTGACCCCCACCACTGG - Intronic
1048451487 8:134537600-134537622 TCCCACCTGACACCTACCAGGGG - Intronic
1048906167 8:139091566-139091588 GCCTGCCTGCCAGCCATCACTGG + Intergenic
1049264469 8:141660091-141660113 TCCTGCCAGACAGCCCCCTCCGG + Intergenic
1049462551 8:142736844-142736866 TCTTGCCTTACAGCCACCATGGG + Exonic
1049756114 8:144311979-144312001 TCCTCCTTGACACGCACCAGGGG - Exonic
1051196209 9:14565155-14565177 CCATGCCTGCCTCCCACCACTGG - Intergenic
1053184055 9:35999901-35999923 TACTCCCAGACACACACCACTGG + Intergenic
1057077840 9:92148585-92148607 TCCTGCCTACCAGGCACCACTGG + Intergenic
1057224814 9:93287327-93287349 TCCTGCCAGGCACACGCCACTGG - Intronic
1058887137 9:109330152-109330174 TCCTGCCCAACTCCCAACACTGG - Intergenic
1061177477 9:129006425-129006447 TCCTGCCTGGCAACCCCCAAGGG + Intronic
1061280899 9:129597287-129597309 TCCCGCCTGACGCCCTCCCCAGG - Intergenic
1062141076 9:134959483-134959505 TCCCATCTGACACCCACCAGGGG - Intergenic
1062171812 9:135138876-135138898 TCCTGCCTGAACCCCATCACTGG - Intergenic
1062450597 9:136614196-136614218 TCCTGCCTGAACCCCTCCTCAGG - Intergenic
1062537324 9:137026762-137026784 ACCTTCCTGACAACCACCCCCGG + Intronic
1062656746 9:137607509-137607531 TCCTGCCTGAACCCCAGCCCTGG - Intronic
1186380364 X:9052202-9052224 TCCTGCCTGAGCCCCAGGACAGG + Intronic
1191955399 X:66638427-66638449 TCCTGCCTCACTCCAAACACTGG - Intronic
1195668787 X:107452146-107452168 TCCTGCCTGAGTCCTGCCACAGG - Intergenic
1200690693 Y:6304997-6305019 TGCTGCCTGACCCACACCACAGG + Intergenic
1201044579 Y:9869719-9869741 TGCTGCCTGACCCACACCACAGG - Intergenic
1202099359 Y:21289620-21289642 TTTTGCCTGACAGTCACCACAGG + Intergenic
1202604410 Y:26626722-26626744 TGCTGCAGGACACCTACCACGGG - Intergenic