ID: 1006059806

View in Genome Browser
Species Human (GRCh38)
Location 6:31411600-31411622
Sequence TGGTGGGTGTCAGGCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059797_1006059806 0 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059798_1006059806 -3 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059796_1006059806 1 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data
1006059794_1006059806 30 Left 1006059794 6:31411547-31411569 CCAGTGTTGTAATCAGGGCAAGT 0: 1
1: 0
2: 0
3: 13
4: 79
Right 1006059806 6:31411600-31411622 TGGTGGGTGTCAGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059806 Original CRISPR TGGTGGGTGTCAGGCAGGAG AGG Intronic
No off target data available for this crispr