ID: 1006059810

View in Genome Browser
Species Human (GRCh38)
Location 6:31411618-31411640
Sequence AGAGGAAGCCTTCAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006059805_1006059810 -1 Left 1006059805 6:31411596-31411618 CCTGTGGTGGGTGTCAGGCAGGA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059798_1006059810 15 Left 1006059798 6:31411580-31411602 CCGACAGAATCCTGAGCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 188
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059797_1006059810 18 Left 1006059797 6:31411577-31411599 CCTCCGACAGAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059802_1006059810 5 Left 1006059802 6:31411590-31411612 CCTGAGCCTGTGGTGGGTGTCAG 0: 1
1: 0
2: 6
3: 30
4: 326
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data
1006059796_1006059810 19 Left 1006059796 6:31411576-31411598 CCCTCCGACAGAATCCTGAGCCT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 1006059810 6:31411618-31411640 AGAGGAAGCCTTCAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006059810 Original CRISPR AGAGGAAGCCTTCAGGGCCA GGG Intronic
No off target data available for this crispr