ID: 1006061350

View in Genome Browser
Species Human (GRCh38)
Location 6:31422257-31422279
Sequence ATGCTGTTCTAAAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006061349_1006061350 -10 Left 1006061349 6:31422244-31422266 CCTGCAATAAGTAATGCTGTTCT No data
Right 1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006061350 Original CRISPR ATGCTGTTCTAAAAGAAAAA AGG Intergenic
No off target data available for this crispr