ID: 1006062352

View in Genome Browser
Species Human (GRCh38)
Location 6:31433232-31433254
Sequence GACAGCTCTTAGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006062348_1006062352 16 Left 1006062348 6:31433193-31433215 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG No data
1006062350_1006062352 11 Left 1006062350 6:31433198-31433220 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG No data
1006062349_1006062352 15 Left 1006062349 6:31433194-31433216 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006062352 Original CRISPR GACAGCTCTTAGCCTGTTAC TGG Intergenic
No off target data available for this crispr