ID: 1006062781

View in Genome Browser
Species Human (GRCh38)
Location 6:31437586-31437608
Sequence TCACATAAACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006062781_1006062786 25 Left 1006062781 6:31437586-31437608 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1006062786 6:31437634-31437656 GAAGACAGCAGATACTCGATTGG No data
1006062781_1006062787 28 Left 1006062781 6:31437586-31437608 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1006062787 6:31437637-31437659 GACAGCAGATACTCGATTGGTGG No data
1006062781_1006062784 -7 Left 1006062781 6:31437586-31437608 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1006062784 6:31437602-31437624 TATGTGAGTCCTTATGTGTTAGG 0: 349
1: 430
2: 380
3: 255
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006062781 Original CRISPR TCACATAAACTGAAGGTAAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr