ID: 1006065976

View in Genome Browser
Species Human (GRCh38)
Location 6:31462969-31462991
Sequence CCGAGGGCGGTGCCTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006065961_1006065976 13 Left 1006065961 6:31462933-31462955 CCAGGGCCCGGAGCTTGGCTCTC No data
Right 1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG No data
1006065964_1006065976 7 Left 1006065964 6:31462939-31462961 CCCGGAGCTTGGCTCTCTGGGCT No data
Right 1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG No data
1006065965_1006065976 6 Left 1006065965 6:31462940-31462962 CCGGAGCTTGGCTCTCTGGGCTT No data
Right 1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG No data
1006065958_1006065976 20 Left 1006065958 6:31462926-31462948 CCAAGTCCCAGGGCCCGGAGCTT No data
Right 1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG No data
1006065960_1006065976 14 Left 1006065960 6:31462932-31462954 CCCAGGGCCCGGAGCTTGGCTCT No data
Right 1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006065976 Original CRISPR CCGAGGGCGGTGCCTGGGAT GGG Intergenic
No off target data available for this crispr