ID: 1006067550

View in Genome Browser
Species Human (GRCh38)
Location 6:31472937-31472959
Sequence ACACATGCACAGTGTGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006067546_1006067550 22 Left 1006067546 6:31472892-31472914 CCCTTCAGAACACGCTGCAGGAA No data
Right 1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG No data
1006067547_1006067550 21 Left 1006067547 6:31472893-31472915 CCTTCAGAACACGCTGCAGGAAG No data
Right 1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG No data
1006067549_1006067550 -2 Left 1006067549 6:31472916-31472938 CCGACATCTCTACACAGGCTCAC No data
Right 1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG No data
1006067545_1006067550 23 Left 1006067545 6:31472891-31472913 CCCCTTCAGAACACGCTGCAGGA No data
Right 1006067550 6:31472937-31472959 ACACATGCACAGTGTGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006067550 Original CRISPR ACACATGCACAGTGTGTGCA CGG Intergenic
No off target data available for this crispr