ID: 1006069251

View in Genome Browser
Species Human (GRCh38)
Location 6:31486366-31486388
Sequence TGGGCCTGGGATGTGACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006069251_1006069264 29 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069264 6:31486418-31486440 GAGGTCAGTGTCGTGAGGGGTGG No data
1006069251_1006069256 -2 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069256 6:31486387-31486409 CAACCTGCTGAGATTAGTCGAGG No data
1006069251_1006069259 7 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069259 6:31486396-31486418 GAGATTAGTCGAGGAAGGTCTGG No data
1006069251_1006069258 2 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069258 6:31486391-31486413 CTGCTGAGATTAGTCGAGGAAGG No data
1006069251_1006069261 24 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069261 6:31486413-31486435 GTCTGGAGGTCAGTGTCGTGAGG No data
1006069251_1006069263 26 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069263 6:31486415-31486437 CTGGAGGTCAGTGTCGTGAGGGG No data
1006069251_1006069262 25 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069262 6:31486414-31486436 TCTGGAGGTCAGTGTCGTGAGGG No data
1006069251_1006069260 10 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069260 6:31486399-31486421 ATTAGTCGAGGAAGGTCTGGAGG No data
1006069251_1006069265 30 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069265 6:31486419-31486441 AGGTCAGTGTCGTGAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006069251 Original CRISPR TGGGCCTGGGATGTGACACT AGG (reversed) Intergenic
No off target data available for this crispr