ID: 1006069256

View in Genome Browser
Species Human (GRCh38)
Location 6:31486387-31486409
Sequence CAACCTGCTGAGATTAGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006069251_1006069256 -2 Left 1006069251 6:31486366-31486388 CCTAGTGTCACATCCCAGGCCCA No data
Right 1006069256 6:31486387-31486409 CAACCTGCTGAGATTAGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006069256 Original CRISPR CAACCTGCTGAGATTAGTCG AGG Intergenic
No off target data available for this crispr