ID: 1006071256

View in Genome Browser
Species Human (GRCh38)
Location 6:31499206-31499228
Sequence CTCCCCTCGCCTCCGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006071250_1006071256 6 Left 1006071250 6:31499177-31499199 CCTGCGACTTCTGTCATCCCCAG 0: 1
1: 2
2: 0
3: 14
4: 175
Right 1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG No data
1006071249_1006071256 23 Left 1006071249 6:31499160-31499182 CCGGGCAGAGGATTCTTCCTGCG 0: 4
1: 0
2: 1
3: 6
4: 113
Right 1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006071256 Original CRISPR CTCCCCTCGCCTCCGGCTCC GGG Intronic
No off target data available for this crispr