ID: 1006072288

View in Genome Browser
Species Human (GRCh38)
Location 6:31506648-31506670
Sequence CAGGCTCAGGCTTCTGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006072288_1006072294 -5 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072294 6:31506666-31506688 GCCTGGTGTGGGAGTTAGGCAGG No data
1006072288_1006072297 11 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072297 6:31506682-31506704 AGGCAGGAGAGGAAGCCCTCAGG 0: 2
1: 2
2: 5
3: 53
4: 445
1006072288_1006072296 0 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072296 6:31506671-31506693 GTGTGGGAGTTAGGCAGGAGAGG No data
1006072288_1006072293 -9 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072293 6:31506662-31506684 CTGAGCCTGGTGTGGGAGTTAGG 0: 1
1: 0
2: 0
3: 43
4: 382
1006072288_1006072299 17 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072299 6:31506688-31506710 GAGAGGAAGCCCTCAGGGCCAGG 0: 1
1: 2
2: 2
3: 53
4: 386
1006072288_1006072298 12 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072298 6:31506683-31506705 GGCAGGAGAGGAAGCCCTCAGGG 0: 2
1: 2
2: 7
3: 37
4: 414
1006072288_1006072300 18 Left 1006072288 6:31506648-31506670 CCTCTGACAGAAGCCTGAGCCTG 0: 1
1: 1
2: 3
3: 23
4: 245
Right 1006072300 6:31506689-31506711 AGAGGAAGCCCTCAGGGCCAGGG 0: 1
1: 3
2: 2
3: 32
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006072288 Original CRISPR CAGGCTCAGGCTTCTGTCAG AGG (reversed) Intronic
900365779 1:2311427-2311449 CAGTCTCAGGGTCCTGCCAGCGG - Intergenic
901138013 1:7010056-7010078 CAGGCTCAGGCACTTGCCAGGGG + Intronic
901485541 1:9558208-9558230 GAGGCTCAGCCTTGTGTCTGGGG - Intronic
902105916 1:14035951-14035973 CAGGCTCAGGCTTCAGGCTGAGG + Intergenic
902389961 1:16097710-16097732 CAAGCCCAGCCTTCTGTCTGAGG + Intergenic
902472295 1:16657279-16657301 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
902486508 1:16750167-16750189 CAGGCTCAGGCCTCTGTAGGGGG - Intronic
903744020 1:25574590-25574612 CTGACTCAGGCTACTGCCAGAGG - Intergenic
904253579 1:29240713-29240735 CAGTCTCAGGCTTTTGTGATGGG + Intronic
904402099 1:30263643-30263665 CAGGCTCTGTCCTCTGTCAGTGG + Intergenic
904936232 1:34131646-34131668 CAGGCCCAGGCCTCTCTCTGAGG + Intronic
904937862 1:34144512-34144534 CAGCCTCAGGCTTCCCTCACAGG - Intronic
905492111 1:38352772-38352794 CAGGCTTGGGCTTCTGTGTGAGG + Intergenic
905772744 1:40648943-40648965 CAGGCACTGGCCTCTGACAGGGG - Intronic
912456528 1:109802085-109802107 CAGGATCAGGGCTCAGTCAGAGG - Intergenic
913658508 1:120984628-120984650 CAGACTCAGGCTTCTTACACTGG - Intergenic
914009875 1:143767737-143767759 CAGACTCAGGCTTCTTACACTGG - Intergenic
914648495 1:149676398-149676420 CAGACTCAGGCTTCTTACACTGG - Intergenic
914802404 1:150971282-150971304 CAGGCTCTGTCTTCAGTCAGTGG - Intronic
914997689 1:152559249-152559271 CAAGCCCAGGCTTCCATCAGGGG - Intronic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
924257507 1:242197080-242197102 CAGTCTTGGGCTTCTTTCAGAGG + Intronic
924318625 1:242824731-242824753 GAGGCCCAAGTTTCTGTCAGAGG + Intergenic
1063494559 10:6494985-6495007 CAGGTTCTGGCTTCTGCCCGAGG - Intronic
1065858415 10:29849539-29849561 CTAGCTCAGGCTTCTCTCTGTGG + Intergenic
1068061933 10:52079351-52079373 AAAGCTCAGGCTTCGGGCAGGGG - Intronic
1068121580 10:52786373-52786395 CAGGCTCAGCCTTCTGGCTGTGG + Intergenic
1068870063 10:61933867-61933889 CAGGCTGATTCTTCTGTTAGGGG - Intronic
1069528125 10:69192227-69192249 CAGGTGCAGGCATTTGTCAGTGG - Intronic
1069609036 10:69760000-69760022 CGGGCTCAGGTGGCTGTCAGTGG - Intergenic
1071299204 10:84243936-84243958 CAGGCTCAGGCATTTTTCAATGG - Intergenic
1071894587 10:90051649-90051671 CTGGCTCAGGCTTCTGTTTCAGG + Intergenic
1072798518 10:98375166-98375188 CAGGATCCGTCTTCTGTCTGTGG + Intergenic
1074104069 10:110375939-110375961 CAGGGTCAGGCTGCTCTCACTGG - Intergenic
1074555330 10:114484048-114484070 CTGGCTAAGGCTGTTGTCAGGGG - Intronic
1074771186 10:116735480-116735502 CAAGCTCAGGCTTCTTTATGTGG - Intronic
1075061857 10:119262235-119262257 CACACTTAGGCTGCTGTCAGGGG - Intronic
1076561196 10:131365720-131365742 CAGGGTCTGGCTTCCCTCAGAGG - Intergenic
1076581377 10:131514139-131514161 CAGGCTCAGCCTCCTTCCAGAGG + Intergenic
1076647109 10:131961170-131961192 CAGGCCCAGGCCTCTCCCAGGGG - Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1076910277 10:133384461-133384483 CAGGCTCAGTCTTCAGTCAGTGG + Intronic
1080078399 11:28181417-28181439 CACACACAGGGTTCTGTCAGGGG - Intronic
1080619072 11:33971519-33971541 CAGGCTGAAGCTTCTTTAAGAGG - Intergenic
1080871661 11:36241899-36241921 CTGGCTCAGGCTTCCAGCAGTGG - Intergenic
1082748628 11:56995187-56995209 CATGCTCACCCTCCTGTCAGGGG - Intergenic
1082758594 11:57103682-57103704 CAGCCTCAGGTTTCTTCCAGAGG - Intergenic
1083793164 11:64999064-64999086 CAGACCCTGGCTTCTGGCAGAGG + Intergenic
1085055313 11:73399722-73399744 CAGGCCCAGGCTTCTCTTACTGG - Intergenic
1089605450 11:119638772-119638794 AAGGCTCCGGCTTCTGGGAGAGG + Intronic
1090902334 11:131044076-131044098 AAGGCTCAGGCTTCTGGTTGAGG - Intergenic
1091011912 11:132009205-132009227 CAGGCACAGGCGTATTTCAGGGG - Intronic
1091047851 11:132341005-132341027 CATCCTCAGGCTTCTCACAGAGG - Intergenic
1091673274 12:2467807-2467829 CTGGCCCAGGCGTCTTTCAGGGG - Intronic
1092033529 12:5309989-5310011 GAGGCTCAGGCTTTTATTAGTGG + Intergenic
1093266914 12:17015214-17015236 CAGGTTCAGGCTTCCATAAGGGG - Intergenic
1094534442 12:31308644-31308666 CAGACTCGGACTTCTCTCAGGGG - Intronic
1095777209 12:46023532-46023554 CAGGTTCAGGCTTCCATGAGAGG - Intergenic
1100927198 12:99562340-99562362 CAGGCTGACTCTTTTGTCAGGGG - Intronic
1104406855 12:128525077-128525099 CAGCATCAGGCTTCTCTTAGAGG - Intronic
1104648209 12:130511966-130511988 CAAGCTCAGGCTTCTGTGAGGGG + Intronic
1107967814 13:45613349-45613371 CAAGCTCCAGCTTTTGTCAGGGG + Intronic
1108289145 13:48940501-48940523 CTTTCTCAGGCTTCTGTCACAGG + Intergenic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1113600352 13:111563891-111563913 CAGGGTCAGGCTTCTGGAATTGG + Intergenic
1114622866 14:24108173-24108195 GAAGCTCTGGCTTCTTTCAGGGG + Intronic
1114649524 14:24275466-24275488 CAGGTTCAGGCCTCTGGCAATGG - Intergenic
1114697979 14:24645071-24645093 CAGGCTCAGGCTTGTATGAGAGG + Intergenic
1118589725 14:67392477-67392499 CAGGCTATGGCGGCTGTCAGAGG + Intronic
1118820911 14:69345320-69345342 GAGGCACAGGCTGCTGCCAGGGG + Intronic
1124139701 15:27066663-27066685 CAGGCTCTGGCCTCTCTCTGTGG - Intronic
1124389940 15:29245858-29245880 CAGGCTCAGACTGCTGGCAAAGG + Intronic
1125396379 15:39252580-39252602 CAGGCTCATGCTGCTGACAGGGG + Exonic
1128753534 15:70165676-70165698 CTGGCTCAGGCCTCAGGCAGGGG + Intergenic
1129119012 15:73383738-73383760 CATGCTCAGGCTACTTCCAGTGG + Intergenic
1129717271 15:77859719-77859741 CTGGCTCAGGCCCCTCTCAGAGG - Intergenic
1129740318 15:77986737-77986759 CAGGCTCAGGCATGTGCCCGAGG - Intronic
1129845434 15:78765860-78765882 CAGGCTCAGGCATGTGCCCGAGG + Exonic
1130117155 15:81015092-81015114 CAGGATCAGGCTCCTGTGAATGG + Intronic
1130256414 15:82327999-82328021 CAGGCTCAGGCGTGTGCCCGAGG - Intergenic
1130461765 15:84164580-84164602 CTGGCTCAGGCCCCTCTCAGAGG + Intergenic
1130598538 15:85261989-85262011 CAGGCTCAGGCGTGTGCCCGAGG + Intergenic
1131621129 15:94069287-94069309 CAGGCCCAGGCTTCTCTCAAAGG - Intergenic
1132675853 16:1120975-1120997 CAGGCCCGGGGTCCTGTCAGGGG + Intergenic
1132884575 16:2177002-2177024 CAGGCACTGGCTGCTGTGAGTGG + Exonic
1133250259 16:4476238-4476260 CAGGCTCAGGCTCTGCTCAGCGG - Exonic
1135564159 16:23499069-23499091 AAGGCTCTGGATTCTGTGAGGGG - Intronic
1139937515 16:70582220-70582242 CAGGCTCAGGCCTCCCTCTGGGG + Intronic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1141004780 16:80341757-80341779 AAGGATCAGGCTTCACTCAGTGG + Intergenic
1142412820 16:89924836-89924858 CAGGCCAAGGCAGCTGTCAGAGG - Intronic
1143178089 17:4967972-4967994 CAGCCTCCGGCCTCTGTCTGCGG - Intronic
1144029026 17:11303618-11303640 CAGGCTCAGCCTTCTGCATGTGG - Intronic
1144766795 17:17737620-17737642 AAGGTACAGGCTTCTGGCAGAGG - Intronic
1146385381 17:32367769-32367791 CAGGCTCAGGCAGCTGTCCAAGG + Exonic
1148385070 17:47228381-47228403 GAGGCTCTGGCCTCTGTCAGGGG - Intergenic
1149522431 17:57327813-57327835 CAGGCTCAGCCTTCTGTTCAGGG + Intronic
1149988723 17:61368330-61368352 CAGGGTCACGCTCCTGTCAAAGG - Exonic
1150316883 17:64176226-64176248 CAAGCTCTGGCTGCTGTCTGTGG - Intronic
1151403644 17:73872768-73872790 CAGCTCCAGGCTTCTATCAGTGG - Intergenic
1151789290 17:76293894-76293916 CAGGCTCTGGATTCTGCCAGTGG - Exonic
1152738236 17:82007852-82007874 CTGGCGCAGGCTGCTCTCAGTGG + Intronic
1152883483 17:82833891-82833913 CAGCCTCAGGTTTCCTTCAGAGG + Intronic
1152889359 17:82871693-82871715 CAGGCTCAGGCTACTGTGCTGGG + Intronic
1153978594 18:10290646-10290668 GAAGCTCAGGCCTCTGTCTGGGG + Intergenic
1157223919 18:45846073-45846095 CAGCCTGAGGCTTCTGTGACTGG - Intergenic
1157437632 18:47684235-47684257 CAGGCTCATGTTTATGGCAGAGG - Intergenic
1158228595 18:55228394-55228416 AATGCTGAGGCTTCTGGCAGAGG + Intronic
1160190508 18:76710919-76710941 CAAGAGCAGGCATCTGTCAGTGG - Intergenic
1160502940 18:79411234-79411256 CAGGTCCAGGCTGCTGTCGGTGG - Exonic
1160590446 18:79941609-79941631 CAGGTTCAGGCTTGTCTCAGAGG - Intronic
1161244464 19:3241639-3241661 CAGGCTGAGGCTTCCTTCAGGGG + Intronic
1162412586 19:10515338-10515360 CAGGCTCAGGCCTGAGGCAGTGG + Intronic
1162722517 19:12670729-12670751 CTGGCTCAGGCCTCCGTGAGCGG - Exonic
1162897908 19:13776412-13776434 CACCCTCTGGCTTCTGTGAGAGG - Intronic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166140724 19:40803802-40803824 CAGTCACAGGCTTCTGACTGGGG + Intronic
1167142826 19:47664040-47664062 CAGAGTCAGGCTTCTGCGAGCGG + Intronic
1168078582 19:53993293-53993315 CGGGCTCAGGCTTTTGTCCCTGG - Intronic
1168289520 19:55350717-55350739 CAGGCCCAGGCTTCGACCAGAGG - Exonic
1202704692 1_KI270713v1_random:14073-14095 CAGGCTCAGGCCTCTGTAGGGGG + Intergenic
925317054 2:2934458-2934480 CCTGCTCAGGCCTCTCTCAGCGG + Intergenic
925350485 2:3197859-3197881 CTGCCTCAGGCTCCTCTCAGAGG - Intronic
925712240 2:6752725-6752747 CAGGGGGAGGCTTATGTCAGGGG + Intergenic
926196091 2:10764495-10764517 CAGGCTGAGGCTGTTGGCAGGGG - Intronic
928339926 2:30434020-30434042 AAGGCACCGGCTTCTGTCACTGG - Intergenic
929537306 2:42791878-42791900 CAGGCAGAGGCTACTGGCAGAGG + Intronic
930684976 2:54298619-54298641 AAGGCTCAGGCTACTGGAAGTGG + Intronic
930810199 2:55532116-55532138 CAGCCTCAGACTTCTGTTTGAGG + Intronic
931966581 2:67542748-67542770 CAGGGTCAGGCTTGTGTGAGAGG - Intergenic
935132572 2:100271631-100271653 CTGGCTCAGGCCCCAGTCAGTGG + Intergenic
936847787 2:116857459-116857481 CAGGTTCAGTCTTCTGTATGTGG - Intergenic
937822105 2:126322110-126322132 CAGCCCCAGGTTTCTGTTAGGGG + Intergenic
939864431 2:147456973-147456995 CAGGCTCAGCATGCTCTCAGGGG - Intergenic
940586411 2:155657815-155657837 CAGGCACTGGCTTCTTTCGGTGG - Intergenic
941095633 2:161237715-161237737 GAGGCTGAGGCTGCTGCCAGCGG + Intergenic
944412486 2:199457913-199457935 CCGGCTCTGGCTGCTGGCAGAGG - Exonic
944842195 2:203635122-203635144 CAGGCTCAGGCAGCTGTCCAAGG - Intergenic
946026378 2:216674134-216674156 CTGGCTCAGTCTTTTCTCAGGGG + Exonic
947187406 2:227467467-227467489 CAGGATCAGTCTTCAGTCACTGG + Intergenic
947660188 2:231860727-231860749 CAGGCACAGGCTGCCGTCACTGG + Intergenic
947865639 2:233396681-233396703 CAGGCTCATGCTTCCCTCAGTGG - Intronic
1169785987 20:9359596-9359618 CAGGCTCAGGCTTCGGCTTGGGG + Intronic
1170654044 20:18269239-18269261 TAGGCTCAGGCTTCTTTAAAGGG - Intergenic
1175488862 20:59365243-59365265 CAGAGTCAGGCCCCTGTCAGAGG - Intergenic
1175618071 20:60420444-60420466 CAGGTTCAGGCTTCTATGAGAGG - Intergenic
1179781306 21:43702616-43702638 CAGCCCCGGGCTTCTGGCAGGGG + Intergenic
1181535607 22:23541435-23541457 CAGGCTGATGTTTCTGTCATCGG + Intergenic
1181694403 22:24585687-24585709 GAGGCTCAGCCTTCCCTCAGTGG - Exonic
1183745581 22:39689781-39689803 CAAGCTGAGGCTTCTCTCAAGGG + Intergenic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
1184996455 22:48210736-48210758 AAGGCTCTGACTTCTGGCAGAGG - Intergenic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
950401692 3:12773958-12773980 CATCCTCAGGCTCCTGTCATTGG - Intergenic
950427633 3:12933025-12933047 CTGGCACAGGCCTCTGTCTGGGG - Intronic
952482729 3:33778270-33778292 TAGGCTGTGGCTTCTGTCTGGGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953884505 3:46707736-46707758 CCGGCTCTGGCTGCCGTCAGTGG + Intronic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
955966924 3:64398311-64398333 CAGGCCCATGCTTTTGTCATTGG - Intronic
961633075 3:128315542-128315564 CAGGCCCTGGCTTCTGGCAGAGG - Intronic
963923999 3:150932195-150932217 CAGTCTCAGACAGCTGTCAGAGG - Intronic
965622602 3:170656005-170656027 CAGGCTCAGGCTTCCATCTCAGG + Intronic
966747996 3:183296554-183296576 CAGGGTCAGGCATGTGACAGAGG - Intronic
966895987 3:184445553-184445575 CAGGCTCAGGCCTCTGCTAAGGG + Intronic
967481047 3:189973846-189973868 CAGCCTAAGGCTTCTGTAAATGG - Intronic
968082544 3:195856769-195856791 CAGGCTTGAGCTTCTTTCAGAGG - Intergenic
968597538 4:1493158-1493180 CAGGCTCTGGCGTGTGGCAGCGG - Intergenic
968654443 4:1772511-1772533 GAAACTCAGGCTACTGTCAGGGG + Intergenic
970222069 4:13821623-13821645 CCAGCCAAGGCTTCTGTCAGTGG - Intergenic
970828167 4:20303661-20303683 CAGCATCAGGCTTAAGTCAGAGG + Intronic
971830930 4:31693434-31693456 CAGGCTCATTCTTTTGTTAGGGG + Intergenic
973662816 4:53125587-53125609 CACGCTCATGTTTCTGTCAATGG + Intronic
973889667 4:55356556-55356578 CAGGCTGAGGCTGCAGTAAGTGG - Intronic
979134141 4:117086950-117086972 CAGGTTCAGGCTTCTTACACAGG + Intergenic
983124618 4:163935246-163935268 CAGGCTGACTCTTCTGTTAGAGG - Intronic
987672967 5:21036973-21036995 CAGGCTCTGCCTTCTCCCAGTGG - Intergenic
989001026 5:36760795-36760817 CAGGCTGACTCTTCTGTTAGAGG - Intergenic
990518922 5:56558746-56558768 CAGGCTCATGCTTGGCTCAGTGG - Intronic
991957908 5:72014214-72014236 CAGGCACACACTTCTGTGAGAGG + Intergenic
996389230 5:122941936-122941958 CAGGCACAGGCTCCTGTGACAGG + Intronic
997610472 5:135212438-135212460 AAGGCTGTGACTTCTGTCAGCGG - Intronic
997865876 5:137462310-137462332 CAGGCTCTGGCTGCTGCCAGAGG - Intronic
999047240 5:148482490-148482512 CAGGGTCAGAGATCTGTCAGAGG - Exonic
1000149530 5:158485942-158485964 CCTGCTCAGTTTTCTGTCAGGGG - Intergenic
1000563696 5:162822220-162822242 CAGGCTCTGGCTTCCATCGGTGG - Intergenic
1001559947 5:172662544-172662566 CTGTCTCAGGCTGCTGGCAGGGG - Intronic
1002565154 5:180108786-180108808 CAGGGCCAGGTTTTTGTCAGAGG + Intronic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1003387045 6:5678455-5678477 CAGGCCATGGCTTCTTTCAGAGG + Intronic
1003830882 6:10010058-10010080 CAGGCTCACTCTCCTGTTAGAGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006084720 6:31587672-31587694 CGGGCTCCTGCTTCTGGCAGTGG + Exonic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1011177226 6:84577143-84577165 CAGGCCCTGGCTTCAATCAGTGG + Intergenic
1012829663 6:104188257-104188279 CAGGTTCAGGCTTGTATGAGAGG + Intergenic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1013016440 6:106164456-106164478 TAGGCCCCGGCTTCTGGCAGTGG + Intergenic
1013290605 6:108716005-108716027 CAGGCTCACGCATCTGACACTGG + Intergenic
1013935076 6:115584563-115584585 CAGCCTCAGGCTTCTGCCTCAGG - Intergenic
1015853800 6:137602706-137602728 CCGCCTCATCCTTCTGTCAGGGG - Intergenic
1017826209 6:158083930-158083952 AAGGCTCAGTCTTCCATCAGTGG - Intronic
1018251601 6:161877286-161877308 CAGCCTCAGGCTCCTGTGAAGGG + Intronic
1022117211 7:27272416-27272438 CAGGCACAGGGTTGTGTGAGGGG + Intergenic
1022840908 7:34163124-34163146 TAGGCTCAGGCTGGTGGCAGAGG + Intergenic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023385324 7:39650978-39651000 AAGGCTGAGGCTTCTGTCCTGGG - Intronic
1024150588 7:46568010-46568032 CAAGGTCAGGCTTCAGTCTGTGG + Intergenic
1024798757 7:53051216-53051238 GAGGCTCAGACTTCTGTAAAGGG - Intergenic
1029459809 7:100688091-100688113 CAGGCTCAGGGCCCTGTCCGGGG - Exonic
1031557714 7:123198679-123198701 CTGGCAAAGGCTTCTGGCAGAGG + Intronic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1034537267 7:151733247-151733269 CAGGCTAAGGCTCCTCTTAGTGG - Intronic
1034876350 7:154728071-154728093 CAGCATCAGGCTGTTGTCAGGGG + Intronic
1035194215 7:157202354-157202376 CCGGCTTAGACTTCTGGCAGAGG - Intronic
1035274564 7:157739931-157739953 CTGGCTCTGGCTTCTGGAAGAGG - Intronic
1036912116 8:12766146-12766168 TAGGCTCAGGCTGCTGTGAATGG + Intergenic
1037891773 8:22627467-22627489 AGGGCTCAGGCTGCTGGCAGGGG + Intronic
1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG + Intronic
1040278274 8:46024929-46024951 AAGGCCCAGGCCTCTGTAAGAGG + Intergenic
1040435660 8:47388656-47388678 TAGGATAAGACTTCTGTCAGGGG - Intronic
1043419287 8:80082720-80082742 TAGGCACAGGCGCCTGTCAGGGG - Intronic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1044999788 8:97869354-97869376 CAGGCTCGGTATTCTGTCGGTGG - Intronic
1046571687 8:115974228-115974250 CAGGCTGATGCTTTTGTTAGGGG - Intergenic
1049249230 8:141579305-141579327 CAGAATCAGGGCTCTGTCAGTGG - Intergenic
1049360321 8:142209685-142209707 GAGGCTCAGGCTGCTGTGGGAGG - Intergenic
1049603344 8:143518162-143518184 CAGAGTCAGGCTCCTGTCTGGGG + Intronic
1049684784 8:143934937-143934959 CAGGCACGGGCGGCTGTCAGGGG + Intronic
1049719440 8:144108807-144108829 CAGGCTCATGCGTCTGGCTGTGG + Exonic
1049788700 8:144463180-144463202 AAGACTCAGGCTTGTGTTAGGGG + Intronic
1050555813 9:6788879-6788901 CAGGCAGAGGCTGCTGTGAGGGG + Intronic
1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG + Intergenic
1052790305 9:32869452-32869474 CAGGCTCAGGCTTCCCACAGGGG + Intergenic
1053149812 9:35736273-35736295 CAGGCTCCCCCTTGTGTCAGAGG - Exonic
1056943672 9:90976096-90976118 CAGGCTGTGGCTTCAGTCAACGG - Intergenic
1057220218 9:93253476-93253498 CAGGCCCAGGGCACTGTCAGTGG - Intronic
1057291920 9:93812340-93812362 CCGGCTCTGGCTTGTGTCACAGG - Intergenic
1059391939 9:114004714-114004736 CATGGCCAGGCTTCTGTAAGTGG - Intronic
1059409273 9:114122029-114122051 CAGGCTCAGCTTTCTCTCTGGGG + Intergenic
1060469737 9:123938556-123938578 CTGGGTCAGGCTTAAGTCAGTGG - Intergenic
1061295088 9:129672558-129672580 CAGGCGCAGGCTGCATTCAGGGG + Intronic
1187148272 X:16657351-16657373 CAGGGCCAGGCTTCTCTCTGGGG + Intronic
1189242934 X:39539794-39539816 TAGACCCAGGCTTTTGTCAGTGG - Intergenic
1190172290 X:48121387-48121409 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190180215 X:48185387-48185409 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190183904 X:48218682-48218704 CAGTCTCATGCTTCTGTCAAGGG - Intronic
1190189829 X:48268134-48268156 CAGTCTCATGCTTCTGTCCAGGG - Intronic
1190199202 X:48345590-48345612 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190204763 X:48394157-48394179 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190205773 X:48401246-48401268 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190210603 X:48443785-48443807 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190420828 X:50282557-50282579 AAGGCTCAGGGTTCTGTAGGTGG + Intronic
1190658579 X:52634634-52634656 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1191036520 X:56030811-56030833 TAGGGGCTGGCTTCTGTCAGCGG + Intergenic
1191684840 X:63879255-63879277 AAGGGTCAGGTTTCTTTCAGTGG - Intergenic
1191853135 X:65601145-65601167 CAGGTTCAGACCTCTGGCAGTGG + Intronic
1192242717 X:69347213-69347235 CTGGCTCAGAGTTCAGTCAGTGG - Intergenic
1192252710 X:69426101-69426123 TAGGCTCAGGCTACTGTCCGTGG - Intergenic
1193492480 X:82166297-82166319 CAGGGACATGCTTCTGGCAGAGG - Intergenic
1195349501 X:103983420-103983442 CGTGCTCAGGCCTTTGTCAGAGG + Intergenic
1195357942 X:104055419-104055441 CGTGCTCAGGCCTTTGTCAGAGG - Intergenic
1195803622 X:108737407-108737429 GAGTCGCGGGCTTCTGTCAGGGG - Intergenic
1196599351 X:117584389-117584411 CAGGTTCAGGCTTGCGTGAGAGG - Intergenic
1199975707 X:152893836-152893858 CAGGCTCTGCCTTTTGTCTGTGG - Intergenic
1202377502 Y:24250570-24250592 CTGGCTCAGGCCCCTCTCAGAGG - Intergenic
1202493279 Y:25419552-25419574 CTGGCTCAGGCCCCTCTCAGAGG + Intergenic