ID: 1006072314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:31506736-31506758 |
| Sequence | AGGAGGGAACTCTCCGGGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 139 | |||
| Summary | {0: 1, 1: 2, 2: 0, 3: 12, 4: 124} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006072314_1006072320 | -7 | Left | 1006072314 | 6:31506736-31506758 | CCCATCCCGGAGAGTTCCCTCCT | 0: 1 1: 2 2: 0 3: 12 4: 124 |
||
| Right | 1006072320 | 6:31506752-31506774 | CCCTCCTGGCCCCATGACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006072314 | Original CRISPR | AGGAGGGAACTCTCCGGGAT GGG (reversed) | Intronic | ||