ID: 1006072314

View in Genome Browser
Species Human (GRCh38)
Location 6:31506736-31506758
Sequence AGGAGGGAACTCTCCGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006072314_1006072320 -7 Left 1006072314 6:31506736-31506758 CCCATCCCGGAGAGTTCCCTCCT 0: 1
1: 2
2: 0
3: 12
4: 124
Right 1006072320 6:31506752-31506774 CCCTCCTGGCCCCATGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006072314 Original CRISPR AGGAGGGAACTCTCCGGGAT GGG (reversed) Intronic