ID: 1006075779

View in Genome Browser
Species Human (GRCh38)
Location 6:31531346-31531368
Sequence CTCCACTAGTAGCTGGGCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006075773_1006075779 10 Left 1006075773 6:31531313-31531335 CCCACGGTGGATGGCAATGGCTG 0: 1
1: 1
2: 0
3: 10
4: 368
Right 1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 120
1006075770_1006075779 20 Left 1006075770 6:31531303-31531325 CCTGGGGCATCCCACGGTGGATG 0: 1
1: 1
2: 0
3: 12
4: 110
Right 1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 120
1006075766_1006075779 28 Left 1006075766 6:31531295-31531317 CCTCTCCTCCTGGGGCATCCCAC 0: 1
1: 0
2: 5
3: 41
4: 341
Right 1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 120
1006075774_1006075779 9 Left 1006075774 6:31531314-31531336 CCACGGTGGATGGCAATGGCTGG 0: 2
1: 0
2: 2
3: 10
4: 270
Right 1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 120
1006075768_1006075779 23 Left 1006075768 6:31531300-31531322 CCTCCTGGGGCATCCCACGGTGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG 0: 1
1: 0
2: 1
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006075779 Original CRISPR CTCCACTAGTAGCTGGGCCA AGG Exonic
900756417 1:4438245-4438267 CTCCACCAATACCTGAGCCAAGG + Intergenic
902869421 1:19304815-19304837 CCTCCCTAGTAGCTGGGACAAGG - Intronic
916479110 1:165199346-165199368 ATCCACTAGGGGCTGGGCCATGG + Intergenic
917051992 1:170935270-170935292 GTCCAGTAGAAGCTGGGCAAAGG - Intergenic
919729141 1:200901815-200901837 GGCCACTAGTCTCTGGGCCAAGG - Intronic
921185384 1:212665549-212665571 CTCCACTCTTCGCAGGGCCAGGG - Intergenic
922786254 1:228283746-228283768 TTGCACTAGGAGCTGGGCCCGGG - Exonic
1063484740 10:6409148-6409170 ATCCACTAGTAACTGGCCCAAGG + Intergenic
1065033259 10:21610189-21610211 CTCTACTAAAAGCTGGGGCAGGG + Intronic
1071503146 10:86217686-86217708 CTCCAGAAGTCACTGGGCCATGG + Intronic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1072624385 10:97101643-97101665 CTCCTCTGATAGCTGTGCCAGGG + Intronic
1074219296 10:111420653-111420675 CTTCCCTTGTGGCTGGGCCAAGG + Intergenic
1075576967 10:123584585-123584607 CTCCACCAGGAACTGGGCCTCGG - Intergenic
1076034657 10:127188982-127189004 CTCCACTGTGAGCTGGGTCAGGG + Intronic
1076859658 10:133134671-133134693 CTCCACTAGGACCTAGACCAAGG - Intergenic
1084033324 11:66493589-66493611 CTGCACGAGCTGCTGGGCCATGG + Exonic
1085736735 11:79045570-79045592 CTCCAGTAGCAGCCAGGCCAGGG - Intronic
1086496998 11:87414601-87414623 CTCCATTAAAAACTGGGCCAAGG + Intergenic
1087182954 11:95157476-95157498 CTCCAGGAGCTGCTGGGCCAGGG + Intergenic
1087362216 11:97175449-97175471 CTCCATTAAAAGCTGGGCAAAGG + Intergenic
1089033697 11:115361846-115361868 CTGCCCAAGTAGCTGGGACATGG + Intronic
1093078302 12:14780039-14780061 CTAGACTAATAGCTGGCCCATGG - Intergenic
1105678860 13:22705334-22705356 CTCCATGAGGAGCTGGGCCGGGG + Intergenic
1105948756 13:25211519-25211541 CTCCCCCAGTAGCTGTGGCACGG + Intergenic
1107147083 13:37070532-37070554 CTCTGCTGGTAGCTGGACCATGG + Intergenic
1107396760 13:40026019-40026041 CTCTACTAATAGCTGAGCCCTGG - Intergenic
1110887113 13:80654425-80654447 CTACACTAGAATCTGGGCCTGGG + Intergenic
1111524683 13:89452799-89452821 CTCCACTTGCCGCTGGGCCAGGG - Intergenic
1113573927 13:111381642-111381664 CTACAGTAGAAGCTGGGGCAGGG + Intergenic
1115289427 14:31753233-31753255 CTCCACTGGTCACAGGGCCATGG + Intronic
1118365954 14:65096261-65096283 CTCCACTAGTAGCTCAGGGATGG - Intronic
1121635302 14:95449988-95450010 CTCCAAGAGCCGCTGGGCCAGGG + Exonic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1125714951 15:41814358-41814380 CAGCACTAGCTGCTGGGCCATGG - Intronic
1129152435 15:73697331-73697353 CACCCCCAGCAGCTGGGCCAAGG - Intronic
1129176140 15:73841024-73841046 TTCCACCAGGAGCTGGACCACGG + Intergenic
1134257059 16:12621256-12621278 CTCCACTTGTAGCCGGGACCTGG - Intergenic
1148836993 17:50470560-50470582 TGCCACTCCTAGCTGGGCCAAGG + Intronic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1152378135 17:79929098-79929120 CTCCACTGGGAGCTGGGGCCAGG + Intergenic
1153863142 18:9234325-9234347 CTCCACCAGTGGCGGGGCGACGG + Intronic
1155983970 18:32210065-32210087 TTCCACTTGGAGCTGGACCAGGG + Intronic
1158339597 18:56450960-56450982 CTACACCAGTCACTGGGCCAGGG - Intergenic
1159535306 18:69707474-69707496 CTGAAATAGTGGCTGGGCCAGGG - Intronic
1160525081 18:79531044-79531066 CTTCTCTAGAAGCGGGGCCAGGG - Intergenic
1162833698 19:13302774-13302796 CTCCACTGGGAGCTGGGGCCGGG + Intronic
1162985473 19:14266609-14266631 CTCCCCGAGTAGCTGGGACTAGG - Intergenic
1163008257 19:14409586-14409608 CTCCACGAGGAGCTGGGCCAGGG + Exonic
1163564259 19:18040561-18040583 CTCCATTATTCCCTGGGCCATGG - Intergenic
1166751848 19:45167874-45167896 CTTCCCAAGTAGCTGGGACACGG - Intronic
925532268 2:4877239-4877261 CTCCATTAAGAGCTGGGCGAGGG - Intergenic
926524145 2:13955430-13955452 CTCAGCTACTAGCTAGGCCAAGG - Intergenic
927458304 2:23276282-23276304 CACCAGAAGTTGCTGGGCCAAGG + Intergenic
928678475 2:33673990-33674012 CACCAAAAGTATCTGGGCCAGGG - Intergenic
929630980 2:43461719-43461741 CTCCCCTAGTATCTGTGGCATGG + Intronic
930754400 2:54960349-54960371 CTCCCCTGGGGGCTGGGCCAGGG + Intronic
935622527 2:105142437-105142459 CTCCCCTAGTGGCAGAGCCAAGG - Intergenic
936531012 2:113277278-113277300 CTCCCCTCCTAGTTGGGCCATGG + Intronic
936992655 2:118382772-118382794 CTCCAATTATATCTGGGCCAAGG - Intergenic
937464065 2:122114472-122114494 CTCCACCAGAAGCAGTGCCAAGG - Intergenic
942062711 2:172242702-172242724 CTTCACTAGAATCTGGGACAAGG + Intergenic
942865667 2:180671535-180671557 CTCCATTAGAAGGTGGGCTAAGG - Intergenic
945267434 2:207904383-207904405 CTGGCCTAGTAGCAGGGCCAAGG - Intronic
948943438 2:241207660-241207682 CTCTTCTCGTACCTGGGCCAGGG - Exonic
1168840238 20:905461-905483 CTCCAGCAGTGGCTGGGCCTGGG - Intronic
1170577059 20:17672064-17672086 CTTCATTACTAGGTGGGCCAGGG + Intronic
1171482839 20:25467000-25467022 CTCCACAAGCAGCTGGGCCTCGG + Intronic
1174127647 20:48318929-48318951 CTCTACCAGTTGATGGGCCAGGG - Intergenic
1174164405 20:48574631-48574653 CTCCAAAAGCAGCTGGACCAAGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179983279 21:44907401-44907423 GTCCTCTAGCAGCTGGCCCAGGG + Intronic
1181803902 22:25363798-25363820 CTTCCCTAGCAGCTGGTCCAGGG - Intronic
1182423172 22:30258189-30258211 CTCCACCAGGGGCTGGGACATGG - Intergenic
1183281277 22:36933891-36933913 CTCCACCAGGTACTGGGCCAGGG + Exonic
1183363133 22:37393333-37393355 CTCCACTCGCACCTGGGCCTGGG + Intronic
1183917607 22:41135028-41135050 CTCCAAGAGTAGCTGGGACTAGG + Intronic
1184274460 22:43402221-43402243 CGCCACTCCTACCTGGGCCAAGG - Intergenic
952902698 3:38120616-38120638 CTCCACATGTAGGTGGGCCTGGG - Intronic
955059037 3:55481330-55481352 CTCCACTTGTTGCTCGGCCCAGG - Intronic
956392580 3:68789107-68789129 CCCCCCTAGTAGCTGGGACTAGG - Intronic
957757071 3:84503976-84503998 CTTCCCTAGTAGCTGGGACTAGG - Intergenic
961264717 3:125632550-125632572 GTCCACTAGGAGATGGCCCAGGG - Intergenic
961754648 3:129120942-129120964 CTCCGCTAGTACCTGGAACAGGG + Intronic
969707203 4:8818530-8818552 CTCCCCAAGCACCTGGGCCAGGG - Intergenic
972458390 4:39276183-39276205 CTTCACTGGTAGCTGGGCTTGGG + Intronic
973101963 4:46283438-46283460 GTCCACAAGTAGTTGGTCCAAGG - Intronic
974609455 4:64196811-64196833 ATTCACTAGTAGCTTGGGCATGG + Intergenic
984630674 4:182057445-182057467 CTGCACTACTGCCTGGGCCATGG - Intergenic
985277569 4:188252727-188252749 CTTCAACAGGAGCTGGGCCACGG - Intergenic
990169340 5:53030374-53030396 CTCTATTATTGGCTGGGCCAGGG + Intronic
990321985 5:54638923-54638945 CTGCTCTAGTAGCTGGCCCATGG - Intergenic
992415308 5:76546989-76547011 CTCCACTACCAGCTGTACCAAGG - Intronic
996803461 5:127428963-127428985 CTCCACAAGTTGCTAGGCAATGG - Intronic
998173073 5:139883650-139883672 CTCACCTAGTAGAGGGGCCAGGG - Intronic
1002299170 5:178247814-178247836 CTCCACTATGAGCTGAGCCTAGG + Exonic
1002469942 5:179429124-179429146 CTGCACTGGCAGCTGGGCCAGGG + Intergenic
1003051267 6:2783033-2783055 CTCCAGTAGATGGTGGGCCACGG + Intronic
1003500654 6:6700268-6700290 CTCCTCTGAAAGCTGGGCCAAGG + Intergenic
1006075779 6:31531346-31531368 CTCCACTAGTAGCTGGGCCAAGG + Exonic
1006845694 6:37059872-37059894 TTCCCCCAGTAGCTGGGCCTGGG - Intergenic
1006938351 6:37734102-37734124 CACAAATATTAGCTGGGCCATGG + Intergenic
1007594542 6:43043435-43043457 CTCCACTACTCACTGGGCCGAGG + Exonic
1010302643 6:74280073-74280095 CTCCATTAGTAGGAGGGCAAGGG + Intergenic
1019449590 7:1090444-1090466 CCCCACTCGCAGCAGGGCCAGGG + Intronic
1023058417 7:36308003-36308025 CTAGAATAGGAGCTGGGCCAGGG + Intergenic
1024467534 7:49728308-49728330 CTTCACTAGAAACTGGTCCAGGG - Intergenic
1029110331 7:98210760-98210782 CTCCACTCGTGGCGGGGCCCGGG - Intergenic
1032388098 7:131538360-131538382 CCCCACTAGCTGCTGTGCCAGGG - Intronic
1032408276 7:131673636-131673658 CTTCACTGGTATCTGGCCCAGGG + Intergenic
1036717430 8:11139378-11139400 CTCCTCTAGTGGCTGGTGCAGGG - Intronic
1038011405 8:23479498-23479520 CTCCAGAAGTGGCTGGGCCCGGG - Intergenic
1039162224 8:34635044-34635066 CTCCAATATTAGCTCTGCCAAGG + Intergenic
1040878213 8:52175232-52175254 CTAAAATAGTAGCTGGGGCAGGG - Intronic
1046733940 8:117755737-117755759 CTTCATTTGTACCTGGGCCATGG + Intergenic
1049772662 8:144390943-144390965 CTCTACGTGAAGCTGGGCCAGGG + Exonic
1053146126 9:35713224-35713246 CTCTCCCAGTAGCTGGGCGATGG + Exonic
1057060543 9:92000067-92000089 CCCCATTAGTATCTGGGACATGG - Intergenic
1059404503 9:114091736-114091758 CTCCACCTGCAGCTGGGCTAGGG - Exonic
1061679856 9:132237632-132237654 CTCCTGGAGTAGCTGGGTCAAGG + Intronic
1062199105 9:135291711-135291733 CTCCTCTACCAGCAGGGCCATGG - Intergenic
1062343641 9:136104837-136104859 CTCCACTAGAGGCTAAGCCAGGG + Intergenic
1187007716 X:15248751-15248773 CTCCAAGAAGAGCTGGGCCAAGG + Exonic
1194750015 X:97673665-97673687 CACCACCAGTGGCTGGGCAATGG - Intergenic
1196627524 X:117893639-117893661 TTCCCCTAGCAACTGGGCCAGGG + Intergenic
1198739298 X:139823973-139823995 CTCCATTAAAAGCTGGGCAAAGG + Intronic
1200691953 Y:6314763-6314785 CTCCACTTGGACCAGGGCCAGGG + Intergenic
1201043319 Y:9859960-9859982 CTCCACTTGGACCAGGGCCAGGG - Intergenic