ID: 1006076392

View in Genome Browser
Species Human (GRCh38)
Location 6:31535250-31535272
Sequence TTGGGCACAAGCCGCCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006076392 Original CRISPR TTGGGCACAAGCCGCCTTCT TGG Intronic
901245327 1:7725850-7725872 ATGAGCAGAAGCCGCCATCTAGG + Intronic
905880425 1:41459782-41459804 ATGGGCAGAAGCCCCCATCTGGG - Intergenic
912748471 1:112265847-112265869 TAGGGCACTAGCCTCCCTCTTGG + Intergenic
921066990 1:211630461-211630483 TTGGTCACATGCTGGCTTCTTGG - Intergenic
922680391 1:227590497-227590519 TTGGGCACAAGACGGCTCGTGGG - Intronic
923351130 1:233108125-233108147 TGGGCCACCAGCAGCCTTCTGGG + Intronic
1065140228 10:22713576-22713598 CTGGGCACAAGTCGGCTTTTTGG - Intronic
1069801692 10:71085781-71085803 CTGGGCGCAGGCCGCCTTCAGGG - Intergenic
1072335190 10:94391541-94391563 TTGGGCACAAGACAGCTTGTGGG + Intergenic
1075779977 10:125011160-125011182 TGGGGCACATCCAGCCTTCTGGG - Intronic
1078473749 11:11612774-11612796 CTGGCCACAAGCCTCCTTGTAGG + Intronic
1080905813 11:36543564-36543586 TTGGGCACAGGGGCCCTTCTTGG + Intronic
1083197558 11:61097784-61097806 TTGGGCACAAGACGGCTTGTGGG + Intergenic
1084573029 11:69970866-69970888 TTGAGCCCAAGCAGCCATCTTGG - Intergenic
1091358846 11:134958408-134958430 CTGGCCACAGGCCACCTTCTGGG - Intergenic
1096336981 12:50764186-50764208 CGGGGGACAAGCCTCCTTCTCGG - Intronic
1100281710 12:93124715-93124737 TAGGGCTCCAGCCTCCTTCTTGG - Intergenic
1102029086 12:109729751-109729773 TTGGGGACAAGCTGGCTGCTGGG - Intronic
1102493252 12:113301874-113301896 TTGGGAGGATGCCGCCTTCTGGG + Intronic
1106704685 13:32267885-32267907 ATGGGAACATGCCGCCTACTTGG + Intronic
1113632116 13:111894966-111894988 GACGGCACAAGCTGCCTTCTGGG + Intergenic
1113765091 13:112876365-112876387 TTAGGCACAAGCAGAATTCTGGG + Intronic
1126656474 15:50983231-50983253 TGGGGCATAAGCAGCCATCTTGG - Intronic
1127841881 15:62838905-62838927 TTTGCCAAAAGCTGCCTTCTGGG - Exonic
1127977895 15:64011952-64011974 TTGGCCACCAGCCACCTTCATGG + Intronic
1130876889 15:88022328-88022350 TTACGCCCAAGCTGCCTTCTTGG + Intronic
1132834782 16:1947288-1947310 CTGGGCCCAGGCCACCTTCTCGG + Exonic
1140322147 16:73963333-73963355 TTGGGATCCAGCCGCCATCTTGG + Intergenic
1145258780 17:21342523-21342545 CTGGGCACAGGCCACCTCCTGGG + Intergenic
1145317844 17:21745481-21745503 CTGGGCACAGGCCACCTCCTGGG - Intergenic
1150494066 17:65593695-65593717 TTGGGGACACGGGGCCTTCTCGG - Intronic
1153049833 18:891397-891419 TTGGGCTCAAGCAACCTCCTTGG + Intergenic
1157204701 18:45688241-45688263 TGGGCCACAAGCCGCCTTCAGGG + Intergenic
1159622961 18:70659966-70659988 TTTTGCACAAGCTTCCTTCTCGG - Intergenic
1161610039 19:5237424-5237446 CTGGGCCGAAGCCGCTTTCTAGG + Intronic
1163681442 19:18684545-18684567 CTGAGCACAATCTGCCTTCTTGG - Intronic
1163724197 19:18913265-18913287 TTGGGAGCAAGCCTCCTTCCTGG - Intronic
1164188595 19:22894984-22895006 TTGGGCTCAAGCCATCTTCCCGG + Intergenic
1165727414 19:38122847-38122869 TTGGTCACATGTCGCCTTGTCGG + Intronic
925752643 2:7103644-7103666 CTGGGCAGAAGCCATCTTCTTGG - Intergenic
926491068 2:13527004-13527026 TTGGGCACAAGACGGCTCGTGGG - Intergenic
931981088 2:67694871-67694893 CTGGCCACAGGCCTCCTTCTTGG - Intergenic
935746835 2:106196215-106196237 TGGGACACCAACCGCCTTCTGGG - Intergenic
942044466 2:172091235-172091257 TTGGGCCCTAGCTGCCGTCTGGG - Intergenic
944847378 2:203682193-203682215 TTGAGCATAAGCTGCCTTCATGG - Intergenic
946321804 2:218959049-218959071 CAGGTCACAACCCGCCTTCTTGG - Intergenic
1171121064 20:22568956-22568978 CCGGGCACACGCCGCCTTCCCGG + Intergenic
1176139004 20:63537037-63537059 TTTGGCACAGGCCACCCTCTAGG - Intronic
1183162646 22:36125236-36125258 TGGGGCACTAGAGGCCTTCTGGG - Intergenic
1183334701 22:37239999-37240021 TGGGGCAAAAGCGGCTTTCTAGG + Intronic
1183607303 22:38873042-38873064 TTCGGCAGAAACCGCCTTCGCGG + Intergenic
952966105 3:38622300-38622322 CTGGACACAAGCCCCCTTCCAGG + Intronic
954458658 3:50613427-50613449 TTGGCCAGAAGCCACTTTCTTGG + Intronic
961892473 3:130141995-130142017 ATGGGCACAAGACGGCTTATGGG - Intergenic
964924398 3:161938043-161938065 TTGGGCACAAGACGGCTTGTGGG + Intergenic
969808241 4:9627411-9627433 CTGGGCTCAAGCCGACTTCTGGG + Intergenic
980043542 4:127965144-127965166 TTGGGCGCAAGACGCCTTGTAGG - Exonic
985532864 5:443888-443910 CTGGGCACAAGCGTCCTTCCTGG + Intronic
986154838 5:5164383-5164405 TTTGGCACATGACGCCTTCCTGG + Intronic
986678998 5:10216305-10216327 TTGGGCAGAACCCCCCTTCTCGG - Intergenic
996769642 5:127072897-127072919 TTGGGCAAAAGCAGCCCTCTGGG - Intronic
1003918346 6:10808097-10808119 TAGTGCACAAGGGGCCTTCTGGG - Intronic
1004690452 6:17988030-17988052 GTGAGCTCGAGCCGCCTTCTGGG + Intergenic
1005462312 6:26080703-26080725 TTGGGCACAAGACGGCTTGTGGG + Intergenic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1010289290 6:74116585-74116607 TTGGGACCAGGCTGCCTTCTTGG + Intergenic
1014834971 6:126150813-126150835 TTGGTCACCAGCACCCTTCTAGG + Intergenic
1023756886 7:43427650-43427672 CTGGGCACAACCTGCGTTCTCGG + Intronic
1024575829 7:50763484-50763506 TTAGGCACAGGCATCCTTCTTGG + Intronic
1027425803 7:78060711-78060733 TTGGGCACATGCTGTTTTCTTGG - Intronic
1037752584 8:21692535-21692557 TTGGGCACCAGCTTCTTTCTCGG - Exonic
1047448023 8:124937377-124937399 GTGGGGACAAGCAGCCTTGTGGG + Intergenic
1049634375 8:143679000-143679022 TTGGGCACAAGATGGCTTGTGGG + Intergenic
1052508458 9:29383613-29383635 TAGGGCACAAGACGGCTTGTGGG + Intergenic
1060201774 9:121655551-121655573 TAGGGCACAAGTCTCTTTCTAGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1188042287 X:25382920-25382942 GTGGGCAGAAGCAGCCTTCATGG + Intergenic
1190270663 X:48860730-48860752 TTGGGCACAAGACGGCTTGTGGG + Intergenic
1190771617 X:53519392-53519414 TTGGGCACAAGACGGCTCGTGGG + Intergenic
1194384766 X:93238587-93238609 TTGGGCACAAGATGGCTTGTGGG + Intergenic
1194737669 X:97532473-97532495 CTGGGGAGAAGCCTCCTTCTGGG - Intronic