ID: 1006077765

View in Genome Browser
Species Human (GRCh38)
Location 6:31545401-31545423
Sequence GGTGGCCCTAGGCAGAAATC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006077765 Original CRISPR GGTGGCCCTAGGCAGAAATC CGG Exonic