ID: 1006078181

View in Genome Browser
Species Human (GRCh38)
Location 6:31547703-31547725
Sequence CCCCTCCCCCCAGGTTCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1027
Summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 952}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006078167_1006078181 27 Left 1006078167 6:31547653-31547675 CCTACGGCTCTGGGGGTACTTGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1006078181 6:31547703-31547725 CCCCTCCCCCCAGGTTCCAGAGG 0: 1
1: 0
2: 1
3: 73
4: 952

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006078181 Original CRISPR CCCCTCCCCCCAGGTTCCAG AGG Exonic
900019244 1:176114-176136 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
900049501 1:534701-534723 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
900071733 1:776516-776538 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
900090206 1:916996-917018 ACCCTGCCCACGGGTTCCAGAGG + Intergenic
900174685 1:1286509-1286531 CCTCTCCTCCCAGGCTCCCGAGG - Intronic
900183366 1:1322123-1322145 TCCCTTCCCACAGGTGCCAGAGG - Intronic
900606620 1:3526480-3526502 CTCCACCTCCCAGGTTCAAGCGG + Intronic
900893567 1:5467020-5467042 CCCCTCTGCTCATGTTCCAGTGG - Intergenic
901015879 1:6230197-6230219 CTCCACCTCCCAGGTTCAAGCGG + Intronic
901150677 1:7099131-7099153 CTCCACCTCCCAGGTTCAAGTGG + Intronic
901205529 1:7493632-7493654 CCCCCCCCCCCAGTTCCCTGGGG - Intronic
901208015 1:7508337-7508359 CCCCACGTCCCAGCTTCCAGGGG - Intronic
901476586 1:9494232-9494254 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
901576641 1:10206376-10206398 CTCTGCCCCCCAGGTTCAAGCGG - Intergenic
901577843 1:10215259-10215281 CTCCACCTCCCAGGTTCAAGCGG + Intronic
901773789 1:11545241-11545263 CCCGCCCCACCAGGTTTCAGAGG + Intergenic
901865783 1:12105852-12105874 CACCGCCTCCCAGGTTCAAGTGG - Intronic
902216067 1:14935208-14935230 TCCCTCCCACCAGGGTACAGTGG + Intronic
902311306 1:15584044-15584066 CTCCTCTCCCCAGCTTACAGTGG - Intronic
902354612 1:15888406-15888428 CTCCACCTCCCAGGTTCAAGTGG + Intronic
902368135 1:15990481-15990503 CACCTCCAGCCAGGCTCCAGGGG + Intergenic
902813837 1:18904802-18904824 TCCCTCCCCCCAGGGCCCTGGGG + Exonic
902919614 1:19658047-19658069 CCCTCGCCCCAAGGTTCCAGAGG + Exonic
902940561 1:19797777-19797799 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
903298016 1:22358047-22358069 CCCATCCCGCATGGTTCCAGTGG + Intergenic
904530094 1:31162712-31162734 CTCCGCCTCCCAGGTTCAAGAGG - Intergenic
905338602 1:37262647-37262669 CCCCTCCCCCAATTTTCCAGAGG + Intergenic
905415613 1:37801762-37801784 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
905444099 1:38013797-38013819 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
905453361 1:38071249-38071271 CCCTTCCCTCCATGTTCCTGAGG + Intergenic
905461621 1:38126233-38126255 CCCCAGCCCTCAGGTTCCTGGGG - Intergenic
905542921 1:38774406-38774428 CCCCACACCCCAACTTCCAGGGG + Intergenic
906434605 1:45784785-45784807 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
906617000 1:47240302-47240324 CCCCACCTCCCGGGTTCAAGCGG + Intergenic
907201896 1:52734563-52734585 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
907201970 1:52735113-52735135 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
907376704 1:54050208-54050230 CTCCACCGCCCGGGTTCCAGCGG + Intronic
908524095 1:64970677-64970699 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
908768585 1:67575474-67575496 GTCCTTCCCCCAGGTTCCTGTGG + Intergenic
908845695 1:68322105-68322127 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
909369348 1:74865810-74865832 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
910188612 1:84572761-84572783 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
910873063 1:91852649-91852671 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
910909879 1:92222154-92222176 CTCCGCCACCCAGGTTCAAGTGG - Intronic
912346574 1:108968553-108968575 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
912349745 1:109000422-109000444 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
912374918 1:109202195-109202217 CTCCACCTCCCAGGTTCAAGTGG + Intronic
912853207 1:113145022-113145044 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
912933693 1:113985086-113985108 CCCCTTCCCCAAGGCTCCTGGGG + Intergenic
914225944 1:145719689-145719711 ACCTTCTCCCCAGGCTCCAGAGG - Intronic
914584086 1:149045407-149045429 CCCCTCCGACCAGCTACCAGTGG + Intronic
914787443 1:150847344-150847366 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
914795935 1:150920349-150920371 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
915134232 1:153718797-153718819 CACCACCTCCCAGGTTCAAGCGG + Intergenic
915412649 1:155714669-155714691 CCTCTGCCCCCAGGTTCAAGTGG - Intronic
915422110 1:155791175-155791197 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
915475941 1:156152954-156152976 CCCCTCCCTAAAGGCTCCAGGGG - Intronic
917118236 1:171623678-171623700 CCCTTCCCCCCAAGGTCAAGAGG - Intergenic
917716781 1:177746298-177746320 TCCCCACCCCCATGTTCCAGAGG + Intergenic
918065703 1:181100088-181100110 CCCCCACCCCCACGTTCCAGAGG - Intergenic
918841028 1:189539794-189539816 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
918978690 1:191526021-191526043 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
919240049 1:194903211-194903233 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
919715934 1:200776637-200776659 CTCCACCTCCCAGGTTCAAGTGG - Intronic
920255038 1:204648931-204648953 CCTCTCCCTCCATGTGCCAGTGG - Intronic
920466585 1:206191810-206191832 CTCCACCTCCCAGGTTCAAGGGG + Intronic
920709587 1:208282407-208282429 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
920828663 1:209446087-209446109 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
921193475 1:212730163-212730185 CTCCACCTCCCAGGTTCAAGAGG - Intronic
921232733 1:213089544-213089566 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
921265540 1:213418029-213418051 CCATTCCCCCCAGCTTCCATGGG + Intergenic
921327154 1:213997657-213997679 GCCCTCCCGCCAGGTTCCTCAGG + Exonic
922361988 1:224831416-224831438 CCCCTAGCCCCAGTTTCAAGAGG - Intergenic
922441319 1:225657338-225657360 AGCCTCCTCCCAGGTTCGAGGGG + Intergenic
922492579 1:226029984-226030006 CACTTCCCCCCAAGTACCAGAGG - Intergenic
922533384 1:226361766-226361788 AGCCTTCCCCCAGTTTCCAGAGG - Intronic
922811454 1:228417362-228417384 CCCGTCCCGCCTGGTTCTAGGGG - Intergenic
923078921 1:230635539-230635561 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
923098835 1:230796238-230796260 CTCCACCTCCCAGGTTCAAGGGG - Intronic
923521848 1:234740863-234740885 CCCCGCCTCCCAGGTTCAAGTGG - Intergenic
924131228 1:240910800-240910822 CTCCGCCTCCCAGGTTCAAGGGG + Intronic
924307187 1:242701958-242701980 CTCCGCCCCTCAGGTTCAAGCGG + Intergenic
924448311 1:244155177-244155199 CCCATGCCCTCAGGGTCCAGGGG - Intergenic
924453871 1:244202293-244202315 TCCCTTTCCCAAGGTTCCAGGGG - Intergenic
924601282 1:245491821-245491843 CTCCACCTCCCAGGTTCAAGTGG - Intronic
924667704 1:246090600-246090622 CCCCATCTCCCAGGTTCAAGTGG + Intronic
924707904 1:246513229-246513251 CACCTCCAGCCAGGCTCCAGGGG - Intergenic
924755097 1:246933216-246933238 CTCCGCCTCCCAGGTTCAAGAGG + Intergenic
1062795740 10:343875-343897 GCCCTGCCCTCAGGATCCAGTGG + Intronic
1062875470 10:939928-939950 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1062932291 10:1361198-1361220 CCCCCTCCCCCAGGCTGCAGGGG + Intronic
1063248602 10:4249790-4249812 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1063451104 10:6150912-6150934 TCCGCCCCCCCAGGTTCAAGCGG - Intronic
1063454704 10:6174898-6174920 CTCCACCTCCCAGGTTCAAGGGG + Intronic
1063681855 10:8196037-8196059 TTCCTCCTCCCAGGTTCAAGTGG + Intergenic
1064171712 10:13039336-13039358 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1064404804 10:15052196-15052218 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1064874640 10:19979461-19979483 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1065777408 10:29133739-29133761 CACCACCTCCCAGGTTCGAGTGG + Intergenic
1065905373 10:30246309-30246331 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1066197507 10:33115516-33115538 CTCCACCTCCCAGGTTCAAGGGG - Intergenic
1066491910 10:35902143-35902165 CTCTGCCCCCCAGGTTCAAGTGG - Intergenic
1067056959 10:43058083-43058105 CACCTCCCCCCATCTTCCCGTGG + Intergenic
1067478996 10:46583538-46583560 CACCTACCCCCACTTTCCAGGGG + Intronic
1067615742 10:47758263-47758285 CACCTACCCCCACTTTCCAGGGG - Intergenic
1069671176 10:70205289-70205311 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1070095937 10:73338513-73338535 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1070786418 10:79164902-79164924 CCCCTTCCCAAAGGTCCCAGGGG + Intronic
1071258211 10:83894278-83894300 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1071817500 10:89248244-89248266 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1072264421 10:93713692-93713714 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1072335917 10:94398275-94398297 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1072592026 10:96834983-96835005 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1072651287 10:97297607-97297629 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1072788291 10:98299590-98299612 TCCCTCCCTCCAGCCTCCAGAGG - Intergenic
1072851109 10:98893150-98893172 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1073023790 10:100470824-100470846 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1073576724 10:104632015-104632037 CTCTTCCCCCCGGGTGCCAGTGG - Intergenic
1073677309 10:105662518-105662540 CTCCACCTCCCAGGTTCAAGAGG - Intergenic
1074326574 10:112456335-112456357 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1074518111 10:114190570-114190592 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1074527829 10:114277266-114277288 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1074569426 10:114611066-114611088 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1074682152 10:115918183-115918205 CTCCGCCTCCCAGGTTCAAGAGG + Intronic
1075039555 10:119097114-119097136 CTCCACCTCCCGGGTTCCAGCGG - Intergenic
1075699649 10:124461202-124461224 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1076285298 10:129289893-129289915 CCCCTCCCTTCAGGTGTCAGTGG - Intergenic
1076414988 10:130279685-130279707 CTCCTCCTCCCGGGTTCCAGTGG + Intergenic
1076463929 10:130665659-130665681 CCAATCCCCCCGGCTTCCAGAGG - Intergenic
1076905701 10:133359740-133359762 CCCCTCCCTCCAGGCTCCCTGGG + Intergenic
1076975847 11:171305-171327 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1077089651 11:772630-772652 CCCCTCCTCCCAGGTTTCCCTGG + Intronic
1077339600 11:2020301-2020323 CTCCGCCTCCCGGGTTCCAGTGG - Intergenic
1078242093 11:9539102-9539124 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1079011730 11:16834093-16834115 CTCCTCCTCCCGGGTTCAAGCGG + Intronic
1079155533 11:17944010-17944032 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1079299338 11:19263754-19263776 CCCCTCTCCCCAGTTTACATGGG + Intergenic
1081621249 11:44620232-44620254 CCCCACTCCCCAGGGGCCAGAGG - Exonic
1083198632 11:61106038-61106060 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1083533618 11:63448272-63448294 CCCCTCTCCACAGGGTACAGAGG + Intergenic
1083619544 11:64042100-64042122 CCCCTCCCGCCTGGTCCCACTGG - Intronic
1083955654 11:65981585-65981607 CCCCTGCCCTCAGGTACCTGAGG + Intergenic
1083995320 11:66268846-66268868 CCCCTCCCCCCAGGGGCCCCAGG + Intronic
1084025684 11:66447530-66447552 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1084124823 11:67092483-67092505 CTCCACCTCCCAGGTTCAAGAGG + Intergenic
1084289665 11:68153709-68153731 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1084616718 11:70241219-70241241 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1084636163 11:70394324-70394346 CACCTCCCCTCATGTTCCATGGG + Intergenic
1085091352 11:73717527-73717549 CTCCGCCTCCCAGGTTCAAGAGG + Intronic
1085107449 11:73857677-73857699 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1085113305 11:73907728-73907750 CCCCTCCCCCATGGTTTCAGTGG - Intronic
1085385936 11:76158437-76158459 CCCCCACCCCCAGGCTCAAGGGG + Intergenic
1085425570 11:76401686-76401708 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1085562022 11:77480606-77480628 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1086002714 11:82000906-82000928 CTCCTCCCCACTGGCTCCAGTGG - Intergenic
1088662263 11:112059475-112059497 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1088891897 11:114051095-114051117 CTCCGCCTCCCAGGTTCAAGAGG - Intergenic
1089265802 11:117260737-117260759 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1089286510 11:117411156-117411178 CTCCTCCCCACAGGGGCCAGAGG - Intronic
1089373135 11:117975666-117975688 CCCTGTCCCCCAGGCTCCAGGGG - Intergenic
1089645629 11:119876694-119876716 CCCCTCCCCCCAGGTCAGATAGG - Intergenic
1089657909 11:119965114-119965136 CCCCTCCCCACAGGTGCCTTGGG + Intergenic
1089714213 11:120341140-120341162 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1089959798 11:122606062-122606084 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1090378590 11:126309107-126309129 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1090530166 11:127582745-127582767 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1090726438 11:129531135-129531157 TCCCTTCCCCCAACTTCCAGAGG - Intergenic
1090801791 11:130177476-130177498 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1091279410 11:134373621-134373643 CCCCTCACCCCAGCTTCCCAGGG + Intronic
1091342000 11:134823303-134823325 CCCCTCTCCCCAGGGACAAGGGG + Intergenic
1202822585 11_KI270721v1_random:75490-75512 CTCCGCCTCCCGGGTTCCAGTGG - Intergenic
1091791788 12:3276110-3276132 CCCCTCCCCTCACCTTCCCGTGG - Intronic
1092039660 12:5372885-5372907 CTCCGCCCCCCGGGTTCAAGAGG + Intergenic
1092062912 12:5565462-5565484 CACCTACCTCCAGGTTCCGGTGG - Intronic
1092222196 12:6722100-6722122 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1092240926 12:6836135-6836157 CTCCACCTCCCAGGCTCCAGAGG - Intronic
1092489892 12:8935539-8935561 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1092874606 12:12837313-12837335 CCCCTGACCCCTAGTTCCAGTGG - Intergenic
1092881566 12:12891334-12891356 CACCCCCGCCCAGCTTCCAGGGG + Exonic
1092883087 12:12902980-12903002 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1093029644 12:14276464-14276486 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1093041975 12:14391804-14391826 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1093587329 12:20855344-20855366 CCTCTACCCCTAGGTACCAGTGG - Intronic
1094071921 12:26425581-26425603 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1094518592 12:31161305-31161327 ACCCTCCCACCACGTTCAAGTGG - Intergenic
1094537676 12:31336563-31336585 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1096046684 12:48568658-48568680 CCCCTAACCCCTGGATCCAGTGG + Intronic
1096362293 12:50998272-50998294 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1096622223 12:52872066-52872088 CCCCTCGCCCCACAGTCCAGAGG + Intergenic
1096651911 12:53066050-53066072 CCAATCACCCCAGCTTCCAGCGG + Intronic
1096828627 12:54298002-54298024 CTCCTCCACCCAGGTTCTGGCGG + Intronic
1096834789 12:54342939-54342961 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1097007281 12:55928308-55928330 TGCCTCCTCCCTGGTTCCAGGGG - Intronic
1097240001 12:57568638-57568660 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1098251076 12:68570080-68570102 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1098263580 12:68696278-68696300 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1098266661 12:68728506-68728528 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1098508691 12:71285199-71285221 CCTCTCCCCACAGGTGCCTGGGG - Intronic
1099938837 12:89160761-89160783 CCTTTCCCACCAGGTGCCAGAGG - Intergenic
1101115831 12:101530401-101530423 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1102000914 12:109557713-109557735 CTCCACCCACCAGGTGCCAGTGG + Intronic
1102102617 12:110292349-110292371 CTCTTCCTCCCAGGTTCAAGTGG + Intronic
1102243460 12:111340109-111340131 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1102303509 12:111788123-111788145 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1102336443 12:112084706-112084728 CTCCACCTCCCAGGTTCAAGAGG - Intronic
1102459676 12:113092948-113092970 GACCTCCGCCCAGGTTCCAATGG - Intronic
1102529630 12:113536776-113536798 ACCCTACCCCCAAGCTCCAGGGG + Intergenic
1102676918 12:114665419-114665441 CCCCCGCCCCCCGATTCCAGAGG + Intergenic
1102710688 12:114924004-114924026 CTCTGCCCCCCAGGTTCAAGCGG + Intergenic
1103332967 12:120167266-120167288 CCTCTCCCCCTGGGTTCAAGCGG - Intronic
1103760454 12:123246140-123246162 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1104324635 12:127784845-127784867 CTCCTCCCCCCAGGGTCAGGAGG - Intergenic
1104454172 12:128896662-128896684 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1104926812 12:132318155-132318177 CCCCACCACCCAGGGTCAAGTGG - Intronic
1105371920 13:19809607-19809629 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1105806854 13:23957015-23957037 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1105914268 13:24897978-24898000 CTCCTCCTCCCGGGTTCAAGTGG + Intronic
1106032117 13:26013071-26013093 CCCCCACCTCCAGATTCCAGAGG + Intronic
1106046909 13:26151345-26151367 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1106519598 13:30485114-30485136 CCCCACCTCCCGGGTTCAAGTGG + Intronic
1106726163 13:32487941-32487963 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1107172514 13:37359265-37359287 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1107327421 13:39259602-39259624 TCCCTCCCCCCAGGGTTCAGGGG - Intergenic
1108207627 13:48106713-48106735 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1108676526 13:52741763-52741785 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1108750880 13:53447240-53447262 CCCCTCCCACCAGTAACCAGGGG + Intergenic
1108775910 13:53764837-53764859 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1108882414 13:55136959-55136981 CTCCTCCCACCAGGCCCCAGGGG - Intergenic
1110830414 13:80024759-80024781 CCCCTCCTCTCATGTTTCAGAGG - Intergenic
1111219902 13:85190602-85190624 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1111568501 13:90047831-90047853 GCCCTCCACCTAGATTCCAGGGG - Intergenic
1112240901 13:97680125-97680147 GGCCACCCCCCAGGCTCCAGGGG + Intergenic
1112896161 13:104303108-104303130 GCCCACCTCCCAGGTTCAAGTGG + Intergenic
1113116181 13:106876935-106876957 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1113450078 13:110402817-110402839 CACCTCCACCCAGCTTCCAAGGG - Intronic
1113756732 13:112817524-112817546 AACCTCCTCCCAGGTTCCAGAGG - Intronic
1114032831 14:18590745-18590767 CCCCCCCCCCCAGGTACCACAGG + Intergenic
1114077620 14:19169793-19169815 CCCCCCCCCCCAGGTACCACAGG + Intergenic
1114084538 14:19229781-19229803 CCCCCCCCACCAGGTACCACAGG - Intergenic
1114147446 14:19993880-19993902 CACCTCCCCCTAGATTTCAGAGG - Intergenic
1114259633 14:21026916-21026938 TCCCTCTCCCCAGGTTCCTCTGG - Intronic
1114264253 14:21062824-21062846 CTCCACCTCCCAGGTTCCAGTGG + Intronic
1114282401 14:21205034-21205056 CCCCTGCTCTCAGGTTCAAGTGG - Intergenic
1114454835 14:22847664-22847686 CCCCGCCCTGCAGGTTCCTGGGG - Exonic
1114676262 14:24442313-24442335 GCCCTCCCACCCGCTTCCAGAGG + Intronic
1115422412 14:33211467-33211489 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1115652426 14:35412477-35412499 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1115735310 14:36321188-36321210 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1115830695 14:37337451-37337473 CTCCGCCTCCCAGGTTCTAGTGG + Intronic
1116189441 14:41645317-41645339 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1117307931 14:54494735-54494757 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1117599004 14:57354526-57354548 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1117953846 14:61107844-61107866 CCCTTTGCCCCAGCTTCCAGTGG + Intergenic
1118186135 14:63540344-63540366 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1118289102 14:64504164-64504186 CCTCTCCACCCAGGCTCCCGCGG - Intronic
1118337033 14:64862285-64862307 TCCCTCCCCTCAAGTGCCAGTGG + Intronic
1118338137 14:64872470-64872492 CCCCTGCCCACAACTTCCAGTGG + Intronic
1118358007 14:65031400-65031422 CCCCGCCTCCCGGGTTCAAGTGG + Intronic
1118601971 14:67477079-67477101 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1118614159 14:67563816-67563838 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1118661933 14:68023410-68023432 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1118712006 14:68527334-68527356 CCCCTTCCCCCACATCCCAGAGG - Intronic
1119235795 14:73018141-73018163 CCACTGCCCCCAGCTTGCAGAGG - Intronic
1120913560 14:89689746-89689768 CTCCGCCTCCCAGGTTCCAGAGG + Intergenic
1121426423 14:93855280-93855302 CTCCGCCTCCCAGGTTCCAGCGG - Intergenic
1121704596 14:95982114-95982136 CCCCTCCCCCAAAGTTGCTGTGG + Intergenic
1122062870 14:99148392-99148414 CCGCTCTCTCCAGGTCCCAGTGG + Intergenic
1122488348 14:102096324-102096346 CCCCTCCCTCCAGCCTCCAGGGG + Intronic
1122656459 14:103264522-103264544 CTCCTCCTCCCAGATTCAAGAGG + Intergenic
1122720366 14:103718500-103718522 CCCTGCCCCACAGGTTCCTGAGG - Intronic
1122735712 14:103839540-103839562 CTCCACCTCCCAGGTTCAAGGGG - Intronic
1122785733 14:104162581-104162603 CCACACCCCCAAGCTTCCAGGGG - Intronic
1122886079 14:104711026-104711048 CCCATCCCACCTGGTGCCAGGGG + Intronic
1123067584 14:105626319-105626341 CCCCGCCCCCTAGGCTGCAGGGG - Intergenic
1123076562 14:105670099-105670121 CCCCGCCCCCTAGGCTGCAGGGG - Intergenic
1123552319 15:21394483-21394505 CTCCGCCTCCCAGGTTCCAATGG + Intergenic
1124039958 15:26092727-26092749 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1124238851 15:28013621-28013643 CCCCTCCCTCCAGCAGCCAGAGG - Intronic
1124251661 15:28110183-28110205 CCCCTCCACCCACTTTCCATTGG - Intergenic
1125706793 15:41744961-41744983 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1126005121 15:44248950-44248972 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1126131269 15:45344028-45344050 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1127181209 15:56420390-56420412 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1128002520 15:64206520-64206542 CTCCACCTCCCAGGTTCCAGCGG - Intronic
1128109584 15:65068014-65068036 CCCCGCCCGCCAGGCTCCACCGG - Exonic
1128184220 15:65630550-65630572 CCCCTCAGCCCAGGCTACAGTGG - Intronic
1128993270 15:72278099-72278121 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1129444095 15:75604243-75604265 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1129889253 15:79060245-79060267 CCCCACCCCCCAGGTTGAATGGG + Intronic
1129891638 15:79075507-79075529 CCCCCAGCCCCAGCTTCCAGAGG - Intronic
1129896440 15:79111309-79111331 CTCTGCCCCCCAGGTTCAAGTGG + Intergenic
1129896450 15:79111348-79111370 TCCTGCCCCCCAGGTTCAAGTGG + Intergenic
1129935484 15:79445631-79445653 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1130087245 15:80787814-80787836 CCCTTCTCTCCAGCTTCCAGAGG + Intronic
1130995302 15:88900155-88900177 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1131154269 15:90065218-90065240 CCCCTCCCCCCAGCGCCCAGCGG - Intronic
1131163832 15:90128090-90128112 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1131490830 15:92861343-92861365 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1131728520 15:95253827-95253849 CTCCACCTCCCAGGTTCAAGGGG + Intergenic
1132503379 16:294668-294690 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1132537454 16:489746-489768 GCCCTCCACCCAGGTTCCCTGGG - Intronic
1132588043 16:714793-714815 CCGCCACCCCGAGGTTCCAGTGG + Intronic
1132610914 16:816006-816028 GCCCTCCCCGCAGGGTCCCGTGG + Intergenic
1132649160 16:1012763-1012785 CCCCTCTGCCCAGGGTCCGGAGG + Intergenic
1132910077 16:2305379-2305401 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1133077126 16:3288728-3288750 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1133165579 16:3944496-3944518 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1134078701 16:11309975-11309997 TCCCTCCCCCCAGCTCCCTGGGG + Intronic
1134414441 16:14031304-14031326 CTCCGCCTCCCAGGTTCCAGAGG - Intergenic
1134690629 16:16188965-16188987 CCCCACCCCCCAGGTCGCACTGG - Exonic
1135380121 16:21989011-21989033 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1135501303 16:22998324-22998346 CCCATTCCCCCAGCTGCCAGGGG + Intergenic
1135525213 16:23208919-23208941 TCCCTCCTCCCACGTCCCAGTGG + Intronic
1135699711 16:24621441-24621463 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1135746485 16:25021190-25021212 CCCCCCGCCCCAGGTTCAAGTGG - Intergenic
1135835634 16:25822820-25822842 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1135898341 16:26431110-26431132 CCCTGCCCCCAGGGTTCCAGAGG + Intergenic
1136159737 16:28411496-28411518 CTCCGCCTCCCAGGTTCAAGAGG + Intergenic
1136166005 16:28453625-28453647 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1136196967 16:28661395-28661417 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1136203352 16:28703798-28703820 CTCCGCCTCCCAGGTTCAAGAGG - Intronic
1136403181 16:30029392-30029414 CCCCCCTGCCCAGGTGCCAGTGG - Intronic
1136576768 16:31129949-31129971 CCCCACCCAGCTGGTTCCAGCGG - Intronic
1137276709 16:46939426-46939448 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1137644496 16:50062404-50062426 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1137923008 16:52510669-52510691 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1138011916 16:53389164-53389186 CTCCGCCGCCCAGGTTCAAGTGG - Intergenic
1138625622 16:58249299-58249321 GTCATCACCCCAGGTTCCAGCGG + Intronic
1139124456 16:64061371-64061393 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1139414927 16:66800875-66800897 GGCCTCCTCCCAGGTTCCACAGG + Intronic
1139416520 16:66815744-66815766 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1139489357 16:67278420-67278442 CCCCTCTCCCCAGGGACCATGGG + Exonic
1139529592 16:67536587-67536609 CCCCTCTTCCCAGGACCCAGGGG - Intronic
1139585206 16:67898318-67898340 CTCCTCCTCCCAGGTTCAAGCGG - Intronic
1139656711 16:68391974-68391996 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1139719460 16:68840983-68841005 CTCCGCCTCCCAGGTTCAAGAGG + Intergenic
1140043288 16:71423737-71423759 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1140311136 16:73849815-73849837 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1140821600 16:78668193-78668215 CTCCGCTTCCCAGGTTCCAGTGG - Intronic
1141449857 16:84091399-84091421 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1141582197 16:85007336-85007358 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1141896038 16:86959325-86959347 CCGCTCCTTCCAGGCTCCAGCGG - Intergenic
1142017409 16:87757381-87757403 CCCCAACTCCCAGGTTCAAGTGG - Intronic
1142018344 16:87764562-87764584 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1142061357 16:88031887-88031909 CACCTACTCCCAGGTTCAAGTGG + Intronic
1142068861 16:88078305-88078327 CCCCTCCACCCAGCGGCCAGTGG - Intronic
1142161244 16:88558725-88558747 CGCATCCCCCCATGCTCCAGGGG + Intergenic
1142444413 16:90126359-90126381 CACCACCTCCCAGGTTCAAGTGG + Intergenic
1142463096 17:109115-109137 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1142501502 17:335746-335768 CCTCCCCTCCCAGGTGCCAGAGG + Intronic
1142545036 17:695223-695245 CCCCTCCCCTCATTTTACAGAGG - Intronic
1142656116 17:1395442-1395464 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1142921810 17:3194893-3194915 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1143107620 17:4537440-4537462 CCCCTTTCCCCAGGTGCCATTGG + Exonic
1143125639 17:4639658-4639680 CCCCTCCCGCCAGGCCCCACCGG - Intronic
1143134524 17:4704109-4704131 CATCTTCCCCCGGGTTCCAGTGG + Exonic
1143168974 17:4915227-4915249 CCCTGCCTCCCAGGTTCAAGGGG + Intergenic
1143402838 17:6657165-6657187 CCCCTCCCGCCAGGCCCCACCGG + Intergenic
1143508687 17:7383696-7383718 CCCCCACCTCCAGGTCCCAGTGG + Exonic
1143793989 17:9321602-9321624 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1144198867 17:12921149-12921171 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1144739433 17:17573102-17573124 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1144775831 17:17784170-17784192 TCCCTCCCCCCAGTCCCCAGGGG - Intronic
1144783931 17:17821595-17821617 CCCCTCCCCTCAGTTTACAGGGG + Intronic
1144867396 17:18345340-18345362 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1144872229 17:18378376-18378398 GCCCTGCACCCAGGCTCCAGGGG - Intronic
1144962269 17:19051590-19051612 CCTCTGCCCCCAGCTCCCAGTGG + Intergenic
1144972892 17:19122930-19122952 CCTCTGCCCCCAGCTCCCAGTGG - Intergenic
1145760942 17:27425283-27425305 CACCTCCAGCCAGGCTCCAGGGG + Intergenic
1146071688 17:29688093-29688115 CCCCGCCCCCCGGGTTCAAGCGG + Intronic
1146160982 17:30559440-30559462 CACCTCCAGCCAGGCTCCAGGGG + Exonic
1146342761 17:32036083-32036105 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1146453355 17:32991707-32991729 CCCTTCCACTCAGGGTCCAGAGG - Intronic
1146617173 17:34366151-34366173 CCCCTCCCCCCACCTCCCTGTGG + Intergenic
1146770813 17:35567427-35567449 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1146977545 17:37127757-37127779 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1147110382 17:38257187-38257209 CCCCGCCCCCCAGGCTCCCCCGG - Intergenic
1147118156 17:38318121-38318143 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1147255959 17:39182241-39182263 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1147383881 17:40070816-40070838 CCCCTCCCCCCAGCCTGCATGGG + Intronic
1147536429 17:41325507-41325529 CACCTCCGGCCAGGCTCCAGAGG + Intergenic
1147588029 17:41664153-41664175 CCCCTGCCCACAGGCTCCTGAGG + Intergenic
1147690428 17:42311633-42311655 CCCCTCACTCCAGATTCCACAGG - Exonic
1147891091 17:43717409-43717431 CCCCCGCTCCCAGGCTCCAGGGG + Intergenic
1147915820 17:43885035-43885057 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1147984374 17:44296533-44296555 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1148058236 17:44814855-44814877 CTCCGCCCCCCGGGTTCAAGTGG - Intronic
1148161400 17:45452145-45452167 CCACTCCCCCCACCATCCAGGGG - Intronic
1148182545 17:45617226-45617248 CTCCTCCTCCCGGGTTCAAGCGG + Intergenic
1148266312 17:46228472-46228494 CTCCTCCTCCCGGGTTCAAGCGG - Intergenic
1148278007 17:46323479-46323501 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1148281628 17:46352575-46352597 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1148300214 17:46541334-46541356 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1148303853 17:46570514-46570536 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1148374936 17:47134558-47134580 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1148419128 17:47531244-47531266 CCCCGCCCCCCAGGCTCCCCCGG + Exonic
1148453148 17:47794073-47794095 CTCCTCCTCCCAGGTTCAAGCGG - Intergenic
1148543220 17:48496634-48496656 CTCCACCCCCCGGGTTCGAGCGG - Intergenic
1148559305 17:48596905-48596927 CCCCTCCCCCCAGGCTCAGGTGG - Intronic
1148664497 17:49364044-49364066 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1148783790 17:50135470-50135492 CCCCTCCCTCCAGGACCCACAGG + Intronic
1148959196 17:51379056-51379078 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1149095367 17:52833389-52833411 CACCACCACCCAGGGTCCAGGGG - Intergenic
1149311285 17:55396698-55396720 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1149602791 17:57904120-57904142 CCCCTCACCCCAGCTGGCAGGGG + Intronic
1149647573 17:58251192-58251214 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1149653150 17:58290970-58290992 CTCCTCCTCCCAGATTCAAGTGG + Intergenic
1149826586 17:59834345-59834367 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1150059073 17:62048318-62048340 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1150202231 17:63369636-63369658 CCCTGCCTCCCAGGTTCAAGTGG + Intronic
1150313861 17:64152320-64152342 CCCATCCCCCCGGATTTCAGGGG - Intronic
1150362844 17:64552786-64552808 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1150392640 17:64798791-64798813 CCACTCCCCCCACCATCCAGAGG - Intergenic
1150402287 17:64867987-64868009 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1150768671 17:68022732-68022754 CCCCGCCTCCCAGGTTCAAGCGG - Intergenic
1151233849 17:72704041-72704063 CTCCACCTCCCAGGTTCGAGTGG - Intronic
1151316065 17:73323477-73323499 CCCCTCCCCCCAGGAACAAGGGG + Intergenic
1151733897 17:75926996-75927018 CCCCACCCTCCAGATGCCAGGGG - Intronic
1151812945 17:76455364-76455386 CTCCAACCCCCAGGTTCAAGTGG - Intronic
1152053913 17:78006911-78006933 CTCCACCCCTCAGGTTCAAGTGG + Intronic
1152106880 17:78335381-78335403 CCCCTCCCATCAGGCTCAAGGGG + Intergenic
1152152357 17:78610179-78610201 CTCCACCTCCCAGGTTCAAGGGG - Intergenic
1152189444 17:78879567-78879589 CCCCTTCCCCAAGGAGCCAGAGG + Intronic
1152356491 17:79810106-79810128 CCCCTCCCCGCCGGCTCCCGGGG + Intergenic
1152431075 17:80248562-80248584 CTCCTCCCCACAGGTGTCAGAGG + Exonic
1152507747 17:80762360-80762382 CCCCTCACCCCAGCCCCCAGTGG - Intronic
1152793435 17:82293922-82293944 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1152836700 17:82537835-82537857 CTCCACCTCCCAGGTTCAAGGGG - Intronic
1153013999 18:566697-566719 CCCTGCCTCCCAGGTTCAAGCGG - Intergenic
1153175799 18:2371574-2371596 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1154125375 18:11688220-11688242 CTCCGCCTCCCCGGTTCCAGTGG - Intergenic
1154274646 18:12948330-12948352 CGCCACCCCACAGCTTCCAGCGG - Intronic
1155534096 18:26797409-26797431 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1155887980 18:31231320-31231342 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1156231268 18:35155933-35155955 CCCCTCCTCCCACCTGCCAGGGG - Intergenic
1158410194 18:57198706-57198728 CCCCAACTCCCAGGTCCCAGGGG + Intergenic
1158518833 18:58153422-58153444 CTCCGCCTCCCAGGTTCCAGCGG + Intronic
1158960306 18:62582592-62582614 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1160355861 18:78227845-78227867 CTCCACCTCCCAGGTTCGAGTGG - Intergenic
1160652813 19:241559-241581 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1160796641 19:948658-948680 CCCCTCCCCACAGAGTCCAGAGG - Intronic
1160814725 19:1029634-1029656 CCCATCTCCCCAGGTTCCCGCGG - Intronic
1160867682 19:1262921-1262943 CCGCTCCACCCACATTCCAGAGG - Intronic
1161055850 19:2190332-2190354 CCCCTACCCCCATGCACCAGGGG - Intronic
1161195921 19:2986627-2986649 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1161506409 19:4646205-4646227 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1161538843 19:4837210-4837232 CTCCACCTCCCAGGTTCGAGTGG - Intergenic
1161541501 19:4854486-4854508 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1161610143 19:5237881-5237903 CCCCACCCCCCCGATCCCAGCGG + Intronic
1161617623 19:5280874-5280896 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1162353576 19:10166476-10166498 CCCATCCACCCAGGCTCCATGGG - Intronic
1163340441 19:16702988-16703010 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1163430388 19:17263780-17263802 CCCCTGCCTCCCGGTTCAAGCGG - Intronic
1163861839 19:19746993-19747015 CTCCTCCCGCCAGGATCCCGGGG + Intergenic
1163993269 19:21020156-21020178 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1164784669 19:30920536-30920558 CCCCACCCCCCACCTTCCCGGGG - Intergenic
1165018701 19:32904674-32904696 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1165174313 19:33916267-33916289 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1165238311 19:34441834-34441856 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1165242833 19:34481629-34481651 CCACTCCCCCCACATTCCAGAGG + Exonic
1165282071 19:34806137-34806159 CCTCTTCCCACAGGTTCCTGTGG - Intergenic
1165290377 19:34879126-34879148 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1165353898 19:35292092-35292114 CCCCTCCCCCTGGGTGCCAGGGG - Intergenic
1165444719 19:35850540-35850562 CCCCTCCCTCCTCGTTCTAGAGG + Intronic
1165577807 19:36836671-36836693 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1165580507 19:36858679-36858701 CTCCACCTCCCAGGTTCAAGGGG - Intronic
1165756781 19:38297967-38297989 ACCATGCCGCCAGGTTCCAGGGG - Intronic
1165952194 19:39480764-39480786 CCCCTCCCCCGCGTTTCCATTGG + Exonic
1166033676 19:40151890-40151912 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1166345281 19:42161776-42161798 TCCCTCCCCTCAGGGACCAGGGG - Intronic
1166535255 19:43569695-43569717 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1166838750 19:45683411-45683433 CTCATTCTCCCAGGTTCCAGGGG - Exonic
1166936321 19:46335352-46335374 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1167170638 19:47829198-47829220 CTCCACCTCCCAGGTTCCAGAGG + Intronic
1167203784 19:48086269-48086291 CCCCTCCCACCCTGTTCCACTGG - Intronic
1167288202 19:48610673-48610695 CCCCTACCTCCGTGTTCCAGGGG + Exonic
1168090801 19:54082059-54082081 CTCCAACCCCCAGGTTCAAGCGG + Intergenic
1168113601 19:54208729-54208751 CCCCTCCCTCCAGGCTGCCGTGG - Intronic
1168252706 19:55149429-55149451 CCCCACACCCCAGGCTCCCGTGG + Intergenic
1168351327 19:55677820-55677842 CCCCTCTGCCCTTGTTCCAGAGG + Intronic
1168417730 19:56179884-56179906 CTCCACCTCCCAGGTTCAAGCGG + Intronic
926121431 2:10243229-10243251 CCCCTCTCCCCAGGTCACAGCGG - Intergenic
926241597 2:11093119-11093141 CCCATCCCTCCAGACTCCAGAGG - Intergenic
926251714 2:11158733-11158755 CTCCACCTCCCGGGTTCCAGCGG - Intronic
927185174 2:20477189-20477211 CCCCACCCCCCAGGTCCCGATGG + Intergenic
927458951 2:23280919-23280941 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
927560800 2:24071518-24071540 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
927591355 2:24360535-24360557 CCCCGCCCCCCGGCTTCCTGCGG - Exonic
927769994 2:25851804-25851826 CCCCACCTCCCAGGCTCAAGCGG - Intronic
928079253 2:28294293-28294315 CTCCACCTCCCAGGTTCAAGTGG - Intronic
928329445 2:30346612-30346634 CCCCTCCATCCAGGCTCCACCGG + Intergenic
928653359 2:33424786-33424808 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
929142035 2:38675088-38675110 CTCCATCCCCCAGGTTCAAGTGG - Intronic
929185288 2:39087761-39087783 CCTCTCCTCCCAGGATCAAGAGG + Intronic
929553580 2:42909540-42909562 CTCCGCCTCCTAGGTTCCAGCGG - Intergenic
929581184 2:43082597-43082619 TCCATCCCCCCAGGGCCCAGGGG + Intergenic
929654414 2:43716206-43716228 CCCCTCCTCCCTTCTTCCAGGGG - Intronic
929838618 2:45432112-45432134 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
930067354 2:47337909-47337931 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
930117498 2:47731067-47731089 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
930784845 2:55261520-55261542 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
931499399 2:62848161-62848183 CTCCACCTCCCAGGTTCAAGCGG + Intronic
931610997 2:64100809-64100831 CGCCGCCTCCCAGGTTCAAGTGG + Intronic
931611871 2:64109593-64109615 CTCCTCCTCCCGGGTTCAAGTGG - Intronic
931733182 2:65171250-65171272 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
931790421 2:65659357-65659379 CCCTTCCCTACAGGTTCGAGAGG + Intergenic
932245815 2:70195394-70195416 CTCCGCCCCCCAGGTTCAAGCGG + Intronic
932435492 2:71700651-71700673 CGCCTCCCCCGGGGTTCCTGGGG - Intergenic
932449578 2:71800848-71800870 CCCCTCCCCAAAGCCTCCAGTGG + Intergenic
932451518 2:71813610-71813632 CTCCTCTCCCCTGGTTCCTGGGG + Intergenic
932536835 2:72606711-72606733 CTCCACCTCCCAGGTTCAAGAGG + Intronic
932847728 2:75152479-75152501 CACCTCCCCCCATGATCCTGAGG + Intronic
932936800 2:76113069-76113091 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
934591311 2:95552469-95552491 CCTCTCACCTCAGCTTCCAGAGG + Intergenic
934652072 2:96098508-96098530 ACACTCCACCCAGGATCCAGTGG + Intergenic
935117039 2:100145650-100145672 CTCCGCCTCCCAGGCTCCAGCGG - Intergenic
935732551 2:106076231-106076253 CACCCCCCACCAGGTTCAAGCGG - Intronic
936015609 2:108956871-108956893 CTCCACCTCCCAGGTTCAAGCGG + Intronic
936101905 2:109589225-109589247 CTCCACCTCCCAGGTTCAAGTGG + Intronic
936595502 2:113843646-113843668 CCCCTCCCACAAGTTTCCATAGG + Intergenic
937215969 2:120313862-120313884 CGCCTTCCCCCAGATTGCAGCGG + Intergenic
937687005 2:124708916-124708938 GCCCTCTGCCCAGGTTGCAGAGG - Intronic
937833172 2:126445382-126445404 CCTCTCCCCCCAGGCTGGAGTGG - Intergenic
937940624 2:127282889-127282911 CCCCAGGTCCCAGGTTCCAGGGG - Intronic
938088422 2:128416935-128416957 GTCCAGCCCCCAGGTTCCAGGGG - Intergenic
938465386 2:131521671-131521693 CCCCTCCCCCCAGTGTCCACAGG + Intergenic
938740936 2:134231687-134231709 CTGCTCCCCACAGGTTCTAGAGG - Intronic
938777549 2:134555263-134555285 CCCCACCCCCCAACTTCCATGGG + Intronic
939256122 2:139746910-139746932 CCCCAAACCCCAGGCTCCAGAGG + Intergenic
939457017 2:142450358-142450380 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
939629905 2:144517831-144517853 CCCCACCCCCCAATTCCCAGAGG + Intronic
940868101 2:158837192-158837214 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
941103953 2:161331345-161331367 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
942302002 2:174571825-174571847 CCTCTGCCTCCAAGTTCCAGCGG - Exonic
942488731 2:176468017-176468039 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
942650792 2:178165276-178165298 CTCCGCCTCCCAGGTTCAAGAGG + Intergenic
945149466 2:206773228-206773250 CTCCACCTCCCAGGTTCAAGTGG - Intronic
945285573 2:208078274-208078296 CCCCTCCCCCAAGGTGGCTGCGG + Intergenic
945449876 2:209981491-209981513 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
945754725 2:213832080-213832102 TCCTTCCCCCCGGGTTCAAGTGG + Intronic
946027310 2:216679633-216679655 CCCCTCCTCCTAGGTTCCCCAGG - Intronic
946190001 2:218003085-218003107 TCCCTCCTCCCAGGCTCCACCGG + Intergenic
946260700 2:218488090-218488112 CCTCTGCCCCCAGTTTCAAGCGG - Intronic
946269271 2:218576880-218576902 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
946289180 2:218730421-218730443 CTCCCCCTCCCAGGTTCAAGTGG - Intronic
946428594 2:219613115-219613137 CCTCTTCCCCCAGGTGCCAGTGG + Exonic
946477732 2:220024896-220024918 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
946624579 2:221596935-221596957 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
946646040 2:221835123-221835145 CTCCACCTCCCAGGTTCCAGTGG - Intergenic
946835012 2:223764001-223764023 CTCCGCCTCCCGGGTTCCAGTGG + Intronic
947588123 2:231369676-231369698 AACCTCCTCCCAGGTTCAAGCGG + Intronic
947697296 2:232202311-232202333 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
947814507 2:233027125-233027147 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
947973256 2:234342467-234342489 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
948011501 2:234652680-234652702 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
948036132 2:234859531-234859553 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
948286456 2:236789725-236789747 CACCTCCTCCCAGGGTCCTGGGG - Intergenic
948504851 2:238421897-238421919 CCCCGACCCCCACGTTCTAGGGG + Intergenic
948547004 2:238739880-238739902 CACCTTCTCCCAGGCTCCAGAGG - Intergenic
948665104 2:239529666-239529688 TCCCTCCTCCCAGGTGCCCGTGG - Intergenic
948831962 2:240602645-240602667 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948831973 2:240602676-240602698 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948831985 2:240602708-240602730 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948831997 2:240602740-240602762 CCACTCCCTCCAGGCTCCTGGGG + Intronic
948832008 2:240602771-240602793 CCACTCCCGCCAGGCTCCTGGGG + Intronic
948900792 2:240956037-240956059 CCCCTCCTGCCTGGTCCCAGTGG + Intronic
1169198724 20:3697375-3697397 CCCCGGCCCCCAGGAGCCAGGGG + Intronic
1169456342 20:5755642-5755664 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1169925025 20:10773993-10774015 CCCATGGCCCCAGGTTCCTGTGG + Intergenic
1170239566 20:14148906-14148928 CCCCTTCCCCCAATTGCCAGTGG + Intronic
1170819491 20:19744409-19744431 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1170821394 20:19758296-19758318 GCCCTCCCCGCAGGTCCCGGAGG - Intergenic
1171451211 20:25237388-25237410 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1172130349 20:32650827-32650849 CCCCACCGCCAAGGTCCCAGAGG + Intergenic
1172258715 20:33542754-33542776 CTCCTCCTCCCAGGCTCAAGTGG + Intronic
1172368491 20:34368183-34368205 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1172537433 20:35684969-35684991 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1172618593 20:36306128-36306150 CCCCTTCCCCCGGGTTGCGGGGG + Intergenic
1172633499 20:36394205-36394227 CCCCATCTCCCAGGCTCCAGGGG + Intronic
1172700681 20:36852057-36852079 ACCTCCTCCCCAGGTTCCAGGGG + Intronic
1172770541 20:37379809-37379831 CTCCGCCTCCCGGGTTCCAGCGG - Intronic
1172815414 20:37682339-37682361 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1172845356 20:37927047-37927069 CTCCTCCTCCCGGGTTCAAGTGG + Intronic
1173251676 20:41366918-41366940 CCCCTCGCCCCAGCTCCGAGCGG + Intergenic
1173368629 20:42413933-42413955 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1173445238 20:43111457-43111479 CTCCACCTCCCAGGTTCAAGAGG - Intronic
1173504603 20:43576855-43576877 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1173508222 20:43606356-43606378 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1173800296 20:45890908-45890930 CCCCTCCCACCCGCTTCCATCGG - Exonic
1173822955 20:46030517-46030539 CCCCACCCCCCACTCTCCAGCGG + Intronic
1173956839 20:47039923-47039945 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1174045282 20:47728728-47728750 CTCCACCTCCCTGGTTCCAGTGG + Intronic
1174182029 20:48681021-48681043 CCCCTGCCCCCAGGTTTTTGAGG + Intronic
1174461283 20:50684688-50684710 TCCCTCCACCCTGGTCCCAGCGG - Intronic
1174648253 20:52104217-52104239 CCCCACCCCTGAGATTCCAGTGG + Intronic
1175004836 20:55671016-55671038 CTCCTCCTCCCGGGTTCAAGAGG + Intergenic
1175387044 20:58604154-58604176 TCTCTTCCCCCAGGTTCTAGAGG - Intergenic
1175738624 20:61404963-61404985 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1175741130 20:61420430-61420452 CCCCTCCCCACAGGGTCCCCAGG + Intronic
1175852014 20:62098709-62098731 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1176006220 20:62864292-62864314 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1176045507 20:63090749-63090771 CGCCTCCCGCAAGGGTCCAGTGG - Intergenic
1176265367 20:64206450-64206472 CCCCTCCCTCCGGGACCCAGGGG - Intronic
1176295878 21:5072379-5072401 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1176384407 21:6131023-6131045 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1177400832 21:20603595-20603617 CTCCTCCTCCCAGGTTCAAGCGG + Intergenic
1177733249 21:25056582-25056604 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1177932818 21:27305828-27305850 CTCCTCCTCCCGGGTTCAAGTGG - Intergenic
1178081106 21:29065995-29066017 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1178258163 21:31074383-31074405 CCACTACCCCCACCTTCCAGGGG + Intergenic
1178665254 21:34540898-34540920 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1178726196 21:35053739-35053761 CCAAGCCTCCCAGGTTCCAGAGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179739065 21:43407226-43407248 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1179861169 21:44189745-44189767 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1179873352 21:44254908-44254930 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1179888398 21:44324274-44324296 CCCCACCCCCCAGGGCACAGTGG - Intronic
1180217657 21:46336059-46336081 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1180237039 21:46468342-46468364 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1180293433 22:10863421-10863443 CCCCCCCCACCAGGTACCACAGG + Intergenic
1180456947 22:15517802-15517824 CCCCCCCCCCCAGGTACCACAGG + Intergenic
1180496238 22:15892836-15892858 CCCCCCCCACCAGGTACCACAGG + Intergenic
1180575053 22:16765699-16765721 CCCCACCTCCCAGGTTCAAGGGG - Intergenic
1180654197 22:17405325-17405347 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1180950101 22:19717074-19717096 CCCTCCTCCCCAGGTGCCAGTGG + Intronic
1181092352 22:20482655-20482677 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1181110795 22:20601764-20601786 CCCCTCACCCCAGTGTCCACGGG - Intergenic
1181292267 22:21805273-21805295 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1181388111 22:22559097-22559119 CCCCTCCCCCGAGCCTGCAGAGG + Intronic
1181502065 22:23321628-23321650 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1181519399 22:23436591-23436613 CCCCTCCCCCCCGGCTCCCAGGG - Intergenic
1181543378 22:23586626-23586648 CTCCTCCTCCCAGGTTCAAGTGG + Intergenic
1181744132 22:24944001-24944023 CCCCTACCCCCAGGATACAGTGG + Intronic
1181788771 22:25246801-25246823 CTCCACCTCCCAGGTTCAAGAGG - Intergenic
1181948372 22:26536477-26536499 CCTCTCTCCCCAGGATCGAGCGG - Exonic
1181998366 22:26901253-26901275 GCTCTGCCCCCAGATTCCAGAGG + Intergenic
1182000290 22:26914378-26914400 CACCTCCCTCCAGGTTCTAATGG + Intergenic
1182631212 22:31687120-31687142 CTCCACCCCCCGGGTTCAAGCGG + Intronic
1183214074 22:36467908-36467930 CCTCTCCACCCAGGTGTCAGCGG - Exonic
1183302970 22:37067383-37067405 CCCCTCCTCCCGGGTTCAAGCGG - Intronic
1183369587 22:37424994-37425016 CCCCTCACCCCATGTTACAGAGG + Intronic
1183524050 22:38313602-38313624 CCCCACCCCCGAGGTTACAGGGG + Intronic
1183581810 22:38730834-38730856 CCCCCACCCCCATTTTCCAGGGG + Exonic
1183651951 22:39161442-39161464 CTCCACCCCACAGGTTCAAGCGG - Intergenic
1183708877 22:39491053-39491075 CCCCTCCCCCCCACCTCCAGTGG + Exonic
1183729061 22:39607006-39607028 CCCCTCCCCACAGGTGGCAATGG - Intronic
1183929066 22:41225781-41225803 CCCCACCCCCCAGGTTCTCCTGG + Exonic
1183989923 22:41590835-41590857 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1183998750 22:41656430-41656452 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1184123215 22:42467434-42467456 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1184234708 22:43176861-43176883 CCCCTCACCCCAGGATTCTGGGG + Intronic
1184561124 22:45263497-45263519 CCCCACCGCCCAGGCCCCAGGGG - Intergenic
1184612119 22:45611150-45611172 TCCCACCCCCCAGGCTCAAGTGG - Intergenic
1184612896 22:45616579-45616601 CCCCTCCCCCCAGTTTCTGTTGG + Intergenic
1184667798 22:45997727-45997749 CTCTGTCCCCCAGGTTCCAGTGG - Intergenic
1184754812 22:46509742-46509764 CCCCTCCTCCCAGCTCCCTGAGG - Intronic
1184764134 22:46562825-46562847 CTCCCACCCCCAGGTTCAAGTGG + Intergenic
1185015147 22:48338685-48338707 TCCCTCCTCCCAGACTCCAGTGG + Intergenic
1185121909 22:48976545-48976567 CCCCTCTCCCCAGGAACAAGCGG - Intergenic
1185229465 22:49671863-49671885 CCCCTCCGCCCTGGCTCCAGCGG - Intergenic
949379345 3:3428030-3428052 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
949562536 3:5215639-5215661 CCTCTCCCACTAGGTGCCAGTGG - Intronic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
949931611 3:9082964-9082986 CACCTCCCTCCAGCTTCGAGAGG + Intronic
950046768 3:9952848-9952870 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
950433508 3:12965455-12965477 CCCCTCCCCCAAGCTTCCCATGG + Intronic
950739192 3:15035941-15035963 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
950966821 3:17152378-17152400 CTCCTCCCTCAAGGTGCCAGGGG - Intergenic
950967120 3:17154302-17154324 CCCTGCCCTCCAGGTTACAGGGG - Intergenic
951475264 3:23098575-23098597 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
951605088 3:24424195-24424217 ACCCTCCGCCCACCTTCCAGAGG + Intronic
952295796 3:32060886-32060908 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
952364174 3:32660393-32660415 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
952446033 3:33381537-33381559 CTCCACCTCCCAGGTTCAAGCGG - Intronic
952881429 3:37988314-37988336 CCCCTCCCCAAACCTTCCAGTGG - Intronic
953416927 3:42727285-42727307 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
953953493 3:47211893-47211915 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
953972137 3:47355941-47355963 CCCCTTTCCCCAGATCCCAGAGG + Intergenic
954121695 3:48503742-48503764 CCCTCCCGCCCATGTTCCAGGGG - Intronic
954226397 3:49184404-49184426 CTCCACCTCCCAGGTTCAAGAGG + Intronic
954253496 3:49387030-49387052 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
954347798 3:50015190-50015212 CCCCGCCTGCCAGGTTCAAGTGG + Intronic
954559727 3:51546553-51546575 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
954688748 3:52384693-52384715 CTCCTCGGCCCAGGTTGCAGTGG + Intronic
955010081 3:55005189-55005211 CTCCTCCTCCAAGGTTCAAGCGG - Intronic
955275489 3:57543405-57543427 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
955366462 3:58314264-58314286 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
955423655 3:58764844-58764866 CCTCTCCCTCCAGTTTCAAGAGG - Intronic
956113561 3:65895967-65895989 CCCCTGCCCCCAGCTTGGAGAGG + Intronic
956837418 3:73106882-73106904 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
957809552 3:85201993-85202015 CTCCTCCTCCCTGGTTCAAGCGG - Intronic
959439711 3:106360552-106360574 ACCCTCCACCTAGGTTTCAGAGG + Intergenic
959575061 3:107925336-107925358 CCCCAAACCCCAGGCTCCAGAGG - Intergenic
960796688 3:121495184-121495206 CCCCGCCTCCCAAGTTCAAGTGG - Intronic
960938677 3:122919478-122919500 CTCCTCTGCCCAGGATCCAGGGG - Intronic
961535671 3:127569071-127569093 CACCTCCCTTCAGCTTCCAGTGG - Intergenic
961547012 3:127641596-127641618 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
961556163 3:127697891-127697913 CCCCACCCCACAGGTCCCATGGG - Intronic
961641947 3:128370421-128370443 CCCCTCCTCCCAGGCCACAGAGG - Intronic
961644898 3:128387716-128387738 CCCCTCCCTACAGGCTCCACTGG + Intronic
961708693 3:128810031-128810053 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
961753625 3:129113248-129113270 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
961825356 3:129596467-129596489 CCCCTCCCCCTGGGTCCCAGAGG + Intronic
961958176 3:130825844-130825866 CCCCTCCTCCCAATTCCCAGAGG - Intergenic
962266749 3:133949314-133949336 CCCCTACCCTCAGATTCCAGGGG + Intronic
962271125 3:133978793-133978815 TCTCTCTCCCCAGCTTCCAGTGG + Intronic
962904369 3:139788829-139788851 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
963137191 3:141917607-141917629 CTCCACCTCCCAGGTTCAAGCGG - Intronic
963552797 3:146745561-146745583 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
963741165 3:149083164-149083186 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
965036154 3:163440331-163440353 CTCCTCATCCCAGGTTCAAGTGG - Intergenic
965313373 3:167159625-167159647 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
967137407 3:186524164-186524186 CTCCGCCTCCCAGGTTCCAGTGG + Intergenic
967489631 3:190075398-190075420 CTCCACCTCCCAGGTTCAAGTGG - Intronic
967604258 3:191425406-191425428 CACCTCCCACCAGGTTCCTCCGG - Intergenic
967653838 3:192021364-192021386 CCCCTCCCCCTAGACTCTAGGGG - Intergenic
967939442 3:194754971-194754993 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
968365032 3:198178480-198178502 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
968516763 4:1018800-1018822 CCCATCCCCCCAGATTCCTGGGG - Intronic
968621528 4:1605432-1605454 ACCCTGCACCCAGCTTCCAGGGG + Intergenic
969136488 4:5033327-5033349 CTTCTCCCTCCAGGTTCCTGTGG + Intergenic
969556468 4:7914830-7914852 CTCCACCTCCCAGGTTCCAGAGG + Intronic
970759631 4:19469223-19469245 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
971048431 4:22831802-22831824 CCCCACCCCCGGGGATCCAGAGG + Intergenic
971192125 4:24437752-24437774 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
971215816 4:24661491-24661513 CTCCGCCTCCCAGGTTCGAGTGG + Intergenic
971308138 4:25501619-25501641 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
972349999 4:38227645-38227667 CCTCGCCTCCCAGGTTCGAGTGG - Intergenic
972436956 4:39044510-39044532 CCCCTAACCCCAGTTTCAAGGGG + Intergenic
972598967 4:40555018-40555040 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
972615942 4:40698280-40698302 CTCCACCTCCCAGGTTCAAGAGG + Intergenic
972868805 4:43269629-43269651 CTCCATCTCCCAGGTTCCAGTGG - Intergenic
973956491 4:56068329-56068351 TCCCTCCCCTCAGGCTGCAGCGG - Intergenic
973988706 4:56381491-56381513 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
973995654 4:56456174-56456196 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
974446663 4:61993374-61993396 CCTCTGCCCCCAGATTCCAGAGG + Intronic
975028628 4:69584564-69584586 CTCTGCCCCCCAGGTTCAAGAGG + Intergenic
975759810 4:77608353-77608375 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
976226055 4:82796733-82796755 TCTCTCCCCCCTGCTTCCAGAGG - Intronic
976320345 4:83707290-83707312 ACCCTCTCACCAGGTTCAAGGGG - Intergenic
976377602 4:84363089-84363111 CCCCTCCCCCTTGGTTCGGGAGG + Intergenic
976517421 4:85984904-85984926 CTCCACCTCCCAGGTTCAAGTGG + Intronic
976729104 4:88244541-88244563 GCCCAGCCCCCAGGCTCCAGGGG - Intergenic
977614652 4:99074713-99074735 CCCTCCCCCCCAAGTCCCAGGGG + Intronic
978330294 4:107604954-107604976 CTCCACCTCCCAGGTTCAAGTGG - Intronic
978512452 4:109535469-109535491 CTCCACCTCCCAGGTTCAAGTGG - Intronic
978784150 4:112590839-112590861 CCTCGCCTCCCAGGTTCAAGTGG - Intronic
979931915 4:126641999-126642021 CCCCGCCTCCCAGGTTTCTGTGG + Intergenic
980001790 4:127497908-127497930 CGCCTCCCACCAGGTTCCTTGGG + Intergenic
980050253 4:128032599-128032621 CTCCACCTCCCAGGTTCAAGCGG - Intronic
980660737 4:135855077-135855099 CCCCAGCCCCCAGGTTCCCCAGG + Intergenic
980917032 4:139043242-139043264 CCCGACCTCCCCGGTTCCAGAGG + Exonic
980965295 4:139515079-139515101 CTCCACCTCCCAGGTTCAAGTGG - Intronic
981938443 4:150257506-150257528 CTCCTCGGCCCGGGTTCCAGCGG + Intergenic
982769738 4:159385928-159385950 CCCCTCCCCTCAGGTCTCAGTGG + Intergenic
982939056 4:161524871-161524893 CTCCCCCTCCCAGGTTCAAGAGG - Intronic
983143781 4:164187492-164187514 CCCATCCCCCCAGGTCCTATGGG - Intronic
984383033 4:179018814-179018836 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
984758955 4:183347714-183347736 CCCCAGCCCCCAGGCCCCAGGGG + Intergenic
985028224 4:185760476-185760498 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
985261471 4:188118681-188118703 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
985324268 4:188750310-188750332 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
985895300 5:2746983-2747005 CCCCTCCACCCATGTCCAAGTGG - Intronic
986482096 5:8199847-8199869 CCTCTGCTCCCAGGTTGCAGAGG - Intergenic
986704960 5:10447284-10447306 CCCCTCCCACCACGAGCCAGAGG + Intronic
987102582 5:14605134-14605156 AACCTCCACCCAGGTTTCAGAGG - Intronic
987143287 5:14966823-14966845 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
987616386 5:20279612-20279634 CTCCACCTCCCAGGTTCAAGCGG - Intronic
988518869 5:31928558-31928580 CTCCGCCTCCCAGGTTCAAGGGG + Intronic
988571186 5:32368318-32368340 CTCCACCTCCCAGGTTCAAGCGG + Intronic
988822841 5:34904507-34904529 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
989174332 5:38507477-38507499 CTCCACCTCCCAGGTTCAAGCGG - Intronic
989216031 5:38905401-38905423 CTCCACCTCCCAGGTTCAAGCGG - Intronic
990051333 5:51505370-51505392 CACCTCCCACCAGGTTCCTGGGG + Intergenic
991095137 5:62731956-62731978 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
991293686 5:65059303-65059325 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
991973817 5:72166355-72166377 CCTCTCCACCAAGGTTCCAGTGG - Intronic
992119101 5:73572880-73572902 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
992745811 5:79819409-79819431 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
993114630 5:83705303-83705325 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
993272312 5:85811730-85811752 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
993378707 5:87180619-87180641 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
994557571 5:101323162-101323184 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
994704279 5:103181481-103181503 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
995114851 5:108468350-108468372 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
995172152 5:109127486-109127508 CTCCACCTCCCAGGTTCAAGGGG + Intronic
996309195 5:122083908-122083930 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
996835558 5:127787995-127788017 CTCCACCTCCCAGGTTCAAGAGG - Intergenic
997148374 5:131463492-131463514 CTCCACCTCCCAGGTTCAAGCGG - Intronic
997194096 5:131966275-131966297 AGCCTCCCCCCAGGCCCCAGAGG + Intronic
997555709 5:134796766-134796788 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
998022282 5:138779798-138779820 CTCCACCTCCCAGGTTCAAGTGG + Intronic
998143681 5:139713494-139713516 CCCCACCACCCAGGGTTCAGGGG - Intergenic
998816861 5:146023291-146023313 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
998833241 5:146181266-146181288 CTCCTCCTCCCAGGTTCAAGCGG - Intronic
999736753 5:154518650-154518672 CCCCTCCGGCCAGGCTTCAGAGG + Intergenic
1000603537 5:163302929-163302951 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1001142626 5:169157475-169157497 CCCCTCCCCCCAGGTATCAGTGG + Intronic
1001316454 5:170644440-170644462 CCCCTCAATCCAGGATCCAGTGG - Intronic
1001745830 5:174091499-174091521 CCCATCCCCCCAGGCTCCCAAGG - Intronic
1002157388 5:177294002-177294024 CGGATCTCCCCAGGTTCCAGAGG - Exonic
1002511979 5:179726201-179726223 CCTCTGCCTCCAGGTTCAAGTGG - Intronic
1002557736 5:180057182-180057204 CCCCTCCCCAGAGGTTTGAGGGG - Intronic
1003320000 6:5042994-5043016 ACCCTCTCCCCAGGGTCCAGAGG - Intergenic
1003490577 6:6617923-6617945 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1003524859 6:6889242-6889264 CTCCGCCTCCCAGGTTCAAGGGG + Intergenic
1003584991 6:7380550-7380572 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1003925133 6:10870532-10870554 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1003934471 6:10960991-10961013 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1003990277 6:11479999-11480021 CCTCTCCCCACAGGTTCCCACGG - Intergenic
1004143471 6:13043340-13043362 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1004197177 6:13515651-13515673 CCTCTACCCCCAGGCGCCAGTGG + Intergenic
1004396737 6:15251925-15251947 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1004396744 6:15251959-15251981 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1004426389 6:15510100-15510122 CCCCGCCCCCCAGGTCCAGGCGG - Intronic
1004468900 6:15910854-15910876 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1004728893 6:18338435-18338457 CTCCACCTCCCGGGTTCCAGCGG + Intergenic
1005053701 6:21709946-21709968 CTCCACCTCCCAGGTTCAAGAGG - Intergenic
1005095430 6:22109770-22109792 GCACTCCCCCAGGGTTCCAGAGG - Intergenic
1005627657 6:27678920-27678942 CTCCTCCTCCCGGGTTCAAGCGG + Intergenic
1005631680 6:27713912-27713934 CTCCACCTCCCAGGTTCCACAGG - Intergenic
1005959878 6:30687117-30687139 CCCCTCCCCCGGGGGTCCCGCGG - Exonic
1006017045 6:31090050-31090072 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1006078181 6:31547703-31547725 CCCCTCCCCCCAGGTTCCAGAGG + Exonic
1006194552 6:32230668-32230690 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1006276141 6:33007048-33007070 CCCCACCCCCCAGACTCCCGGGG + Intronic
1006743996 6:36329003-36329025 CCCCTCCCTCTAGGTGCCAGTGG + Intronic
1006957227 6:37884407-37884429 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1007006839 6:38372060-38372082 CCACTCCTCCCAGGTCCCATGGG + Intronic
1007027530 6:38592096-38592118 CCTCGCCTCCCAGGTTCAAGCGG - Intronic
1007568602 6:42872672-42872694 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1007632921 6:43282885-43282907 CACCACCCCCCAGGTCCCACTGG + Exonic
1007663875 6:43503125-43503147 TCCATCCCCTGAGGTTCCAGGGG - Intronic
1007706717 6:43795595-43795617 CCCCGGCCCCCAGATGCCAGTGG + Intergenic
1008646280 6:53518333-53518355 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1009349936 6:62661557-62661579 CCCCAGACCCCAGGCTCCAGAGG - Intergenic
1009728306 6:67562774-67562796 CTCCGCCTTCCAGGTTCCAGCGG - Intergenic
1010229335 6:73521164-73521186 CCCCTCCCCCCAACTTCTCGGGG + Intronic
1010414091 6:75593857-75593879 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1010699768 6:79029612-79029634 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1011257728 6:85440910-85440932 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1012858885 6:104535079-104535101 CCCCTCCCCCAGGATTCCAGAGG + Intergenic
1013024059 6:106251923-106251945 CTCCACCTCCCAGGTTCAAGAGG + Intronic
1013997342 6:116324101-116324123 CCCCTCACCCCAGGCTCCAAAGG + Intronic
1015169139 6:130231477-130231499 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1015233028 6:130938405-130938427 CCCCTCCCTCCACACTCCAGTGG - Intronic
1015958717 6:138625225-138625247 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1016044283 6:139465362-139465384 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1016402214 6:143693320-143693342 CTCCACTTCCCAGGTTCCAGCGG + Intronic
1016521940 6:144955433-144955455 CCCCTCCTCCCAGACACCAGAGG + Intergenic
1016675796 6:146766340-146766362 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1016710924 6:147170950-147170972 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1017151192 6:151282166-151282188 CTCCGCCTCCCAGGTTCGAGCGG + Intronic
1017740700 6:157404219-157404241 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1017886746 6:158606178-158606200 CCCCTCCCTCCAGCTCCCTGTGG - Intronic
1018520263 6:164641531-164641553 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1018733562 6:166670903-166670925 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1019191958 6:170256687-170256709 CCCCATCCCCCGGGTCCCAGGGG - Intergenic
1019251158 7:12411-12433 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1019481526 7:1269190-1269212 TCCCTCTCCCCAGGTCCCATAGG - Intergenic
1019536421 7:1531707-1531729 TCCCACCCCCCAGGATCTAGAGG - Intronic
1020138457 7:5599250-5599272 CTCCACCCCCCAGGTTCCCTGGG - Intronic
1020169487 7:5833837-5833859 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1020425504 7:8061749-8061771 CTCCTCCTCCCAGGTTCAAGTGG + Intronic
1021563321 7:21990829-21990851 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1021987825 7:26114141-26114163 CTCCCCCTCCCAGGTTCAAGTGG - Intergenic
1022099062 7:27158264-27158286 CCCCTACCCCCAGGCTTCCGTGG - Intergenic
1022156834 7:27669333-27669355 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1022249605 7:28594091-28594113 CCCCTGCCCCCACCTCCCAGTGG + Intronic
1022526982 7:31044447-31044469 CCCCTCCCACCAGGTGCCCCTGG - Intergenic
1023239809 7:38131292-38131314 CTCCACCACCCAGGTTCAAGCGG - Intergenic
1023310444 7:38881196-38881218 ATTCTCCCCCCAGCTTCCAGGGG - Intronic
1023453961 7:40318519-40318541 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1023890756 7:44390277-44390299 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1024634812 7:51278328-51278350 CCCCTCCTCCCAGCTGCCTGGGG + Intronic
1025003332 7:55336646-55336668 TCCCTATCCCCAGATTCCAGGGG + Intergenic
1025055562 7:55761898-55761920 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1025057608 7:55777747-55777769 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1025298266 7:57794415-57794437 CTCCTCCTCCCATGTTCTAGTGG + Intergenic
1025793234 7:64714014-64714036 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1026024162 7:66731944-66731966 CCACTCCCCCCAGGGCCCATGGG + Intronic
1026075986 7:67168794-67168816 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1026700868 7:72643500-72643522 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1026839403 7:73661016-73661038 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1026951702 7:74351749-74351771 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1026968609 7:74454745-74454767 CCCCTCCACCCGGGATTCAGCGG - Intronic
1026986217 7:74556706-74556728 CTCCACCTCCCAGGTTCAAGGGG + Intronic
1028399073 7:90405145-90405167 CTCCACCTCCCAGGTTCAAGCGG + Intronic
1028499438 7:91502425-91502447 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1028787618 7:94813878-94813900 CTCCACCTCCCAGGTTCAAGAGG + Intergenic
1028885547 7:95928566-95928588 CCCCACTCCCCAGATTCCAAGGG + Intronic
1029471692 7:100758667-100758689 ACCCTCCCCCCAGGCCGCAGTGG - Intronic
1029485330 7:100836577-100836599 CCTCCCTCCCCAGGATCCAGGGG + Intronic
1029485387 7:100836791-100836813 CCCCCTCCCCCAGGTCCCAGGGG - Intronic
1029495535 7:100894148-100894170 CTCCTCCACCCAGGAGCCAGAGG + Exonic
1029522005 7:101068791-101068813 CCTCTCCCCCCAGCTCCCGGTGG + Intergenic
1029531023 7:101125376-101125398 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1029577417 7:101412558-101412580 CTCCGCCTCCCAGGTTCAAGGGG - Intronic
1029853743 7:103491742-103491764 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1030194910 7:106843876-106843898 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1031084202 7:117286364-117286386 CCCCTTCCTCCGGGTCCCAGAGG - Intronic
1033216615 7:139498055-139498077 CCCCGCCTCCCAGGTTCAAATGG + Intergenic
1033613136 7:142984814-142984836 CTCCTCCTGCCAGGTTCCAGAGG + Intergenic
1034095661 7:148405510-148405532 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1034611547 7:152375125-152375147 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1034650991 7:152690134-152690156 CTCCACCTCCCAGGTTCCAGGGG + Intergenic
1034973441 7:155433756-155433778 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1035512334 8:201271-201293 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1035793641 8:2332436-2332458 CCTCCCCTCCCAGGTTTCAGTGG - Intergenic
1035799162 8:2389269-2389291 CCTCCCCTCCCAGGTTTCAGTGG + Intergenic
1036210594 8:6837128-6837150 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1036518489 8:9468440-9468462 GCCCTCCACCTAGATTCCAGAGG + Intergenic
1037281954 8:17251176-17251198 CCCTTCCCCCCAAGTTACTGTGG + Intronic
1037699729 8:21263476-21263498 CTCTGCCTCCCAGGTTCCAGTGG - Intergenic
1037854957 8:22365318-22365340 CTCCCCCTCCCAGGTTCAAGTGG - Intergenic
1038680797 8:29665033-29665055 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1039355046 8:36805926-36805948 CTCTACCTCCCAGGTTCCAGTGG + Intronic
1039790513 8:40872317-40872339 CCCAGCCCTCCAGGTGCCAGCGG + Intronic
1040395168 8:46992047-46992069 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1040505710 8:48046029-48046051 CTCCGCCTCCCAGGTTCAAGCGG + Intronic
1040852222 8:51912769-51912791 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1041262718 8:56035768-56035790 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1041622605 8:59990217-59990239 CCCATGGCCCCAGGCTCCAGAGG - Intergenic
1042123127 8:65509104-65509126 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1043444487 8:80305917-80305939 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1043845662 8:85160605-85160627 CCCCAACCCCCAGCTCCCAGCGG - Intergenic
1044236921 8:89841418-89841440 CCCCGCCTCCCAGGTTCAAGCGG - Intergenic
1045152007 8:99418631-99418653 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1045273599 8:100682247-100682269 CTCCTCCTCCCGGGTTCAAGCGG + Intergenic
1045324633 8:101109135-101109157 CCCCTCCGCCCAGGTCCTGGAGG + Intergenic
1046412443 8:113864014-113864036 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1046426046 8:114050883-114050905 CTCCACCTCCCTGGTTCCAGTGG - Intergenic
1046649842 8:116825954-116825976 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1047269371 8:123341025-123341047 CCCCACCTCCCAGATTCAAGCGG + Intronic
1047384518 8:124396639-124396661 CCCCACCTCCCTGGTTCAAGCGG + Intergenic
1047603534 8:126451287-126451309 CTCTGCCTCCCAGGTTCCAGTGG - Intergenic
1048451911 8:134540977-134540999 CCTCTCCCCTCTGGTGCCAGTGG - Intronic
1048983620 8:139716899-139716921 CCCCTCCCCTCAGCTCCTAGAGG - Intergenic
1049086754 8:140484497-140484519 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1049133603 8:140872638-140872660 CCAATCCCCACAGGCTCCAGGGG - Intronic
1049482859 8:142835086-142835108 CCACTCCCCGCAGGTTCCTGGGG + Intronic
1049815471 8:144597125-144597147 GCCCTCCTCCCAGGCTCCACAGG - Intronic
1050158109 9:2689387-2689409 CTCCACCCCCCAGGTTCAAGTGG + Intergenic
1050365440 9:4869423-4869445 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1051273274 9:15375421-15375443 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1051542712 9:18237992-18238014 CCCCTCCCTCCAGCCTCTAGAGG - Intergenic
1052025204 9:23566304-23566326 CTCCTTCCTCCAGGTTCCTGGGG + Intergenic
1052234090 9:26189032-26189054 CCCATGGCCCCAGATTCCAGTGG + Intergenic
1052656010 9:31362075-31362097 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1052860103 9:33432702-33432724 CTCCTCCTCCCAGGTTTAAGAGG + Intergenic
1053158488 9:35796768-35796790 CCCCGCCCCCCACCTTCCAATGG + Intronic
1053357044 9:37455138-37455160 CCCCAAACCCCAGGTTCCACAGG + Intronic
1054959630 9:70953665-70953687 CCCTCCCCACCAGGTTCCAAAGG + Intronic
1056167443 9:83952873-83952895 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1056301815 9:85249786-85249808 CCCCAAACCCCAGGCTCCAGAGG - Intergenic
1056426964 9:86487299-86487321 CACCTCCCACCAGGTGCAAGAGG + Intergenic
1056578361 9:87872571-87872593 TCCTTCCTCCCAGGCTCCAGTGG + Intergenic
1056607431 9:88098056-88098078 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1057357547 9:94344397-94344419 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1057650206 9:96913228-96913250 CTCCGCCTCCCAGGTTCAAGTGG - Intronic
1057835585 9:98442304-98442326 CCCACCACCCCAGTTTCCAGGGG - Intronic
1057859006 9:98625002-98625024 GCCCTCCTCCCAGCCTCCAGAGG + Intronic
1058535756 9:105958408-105958430 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1058571229 9:106347175-106347197 CTCCACCTCCCAGGTTCAAGGGG + Intergenic
1058693249 9:107536844-107536866 CCTCTCTCCCCAGCTCCCAGGGG - Intergenic
1058823614 9:108755132-108755154 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1059105307 9:111506120-111506142 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1059159544 9:112021183-112021205 CTCCGCCACCCAGGTTCAAGCGG + Intergenic
1059283001 9:113150834-113150856 CGCCTCGCCCCAGGTTCCCAAGG - Intergenic
1059348125 9:113646121-113646143 ACCCTCCACCCAGCTGCCAGAGG - Intergenic
1059433966 9:114265511-114265533 CCCACACCCCCAGGTGCCAGCGG - Intronic
1059650187 9:116309158-116309180 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1060131520 9:121104784-121104806 CTCCGCCTCCCAGGTTCAAGTGG + Intronic
1060203983 9:121671064-121671086 CACCACCTCCCAGGTTCAAGCGG - Intronic
1060209407 9:121700597-121700619 CCCCTCCCCCTTGGTTCTAGCGG + Intronic
1060583216 9:124770618-124770640 CCCCTCCCCCCGGGCTCCTCAGG - Intronic
1060642750 9:125252622-125252644 CCCCGCCTCCCAGGTTCAAGCGG + Intergenic
1061094354 9:128446221-128446243 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1061341669 9:129986703-129986725 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1061432444 9:130539838-130539860 CACCTTCCTCCAGGTGCCAGTGG + Intergenic
1061483549 9:130908950-130908972 CCCGACCCCCCATCTTCCAGGGG + Intronic
1061488482 9:130932649-130932671 CCACTCCCCCCAGCTTGGAGGGG + Intronic
1061766834 9:132886894-132886916 CTCCTCCTCCCGGGTTCAAGTGG + Intronic
1062053124 9:134457500-134457522 CCCCACCCCACAGGACCCAGAGG - Intergenic
1062162768 9:135088870-135088892 CCCCTCCCGCTAGGCTCGAGAGG - Intronic
1062467068 9:136686226-136686248 CCCCTTCCCCGTGGTTCCAGGGG - Intronic
1062489627 9:136798992-136799014 CCCCAGGCCCCAGGGTCCAGGGG - Intronic
1062749401 9:138241359-138241381 CACCACCTCCCAGGTTCAAGTGG + Intergenic
1185530658 X:815773-815795 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1185758492 X:2671645-2671667 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1187953383 X:24492502-24492524 CTCCACCCCCCAGGTTCAAGCGG - Intronic
1187960002 X:24559230-24559252 CTCCACCTCCCAGGTTCAAGGGG - Intronic
1187964976 X:24602886-24602908 CTCCACCTCCCAGGTTCAAGTGG + Intronic
1188255913 X:27961636-27961658 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1188400182 X:29734846-29734868 CCCCACCCCCCAATTCCCAGGGG + Intronic
1188565291 X:31520240-31520262 CACCTCCCACCAGGTTCCCCCGG - Intronic
1188732822 X:33672786-33672808 CTCCGCCTCCCAGGTTCAAGTGG - Intergenic
1188874780 X:35416414-35416436 CCCCTCCCCCTCAGTTCCAGTGG - Intergenic
1189904385 X:45742895-45742917 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1189986256 X:46556007-46556029 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1190062056 X:47218057-47218079 CGCCTCCGCCCAGGTTTCATAGG - Intronic
1190163525 X:48052067-48052089 CTCCACCTCCCAGGTTCAAGCGG - Intronic
1190801113 X:53789741-53789763 CTCCGCCTCCCAGGTTCAAGCGG - Intergenic
1190821363 X:53976218-53976240 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1190834712 X:54089872-54089894 CTCCGCCTCCCAGGTTCAAGCGG - Intronic
1191692694 X:63957300-63957322 CCTCTCCCTCTAGCTTCCAGAGG - Intergenic
1192217317 X:69170849-69170871 CTCCACCTCCCAGGTTCAAGTGG + Intergenic
1192321538 X:70094132-70094154 CTCCACCTCCCAGGTTCAAGCGG - Intergenic
1193473232 X:81932625-81932647 CCCCTCCCCACAAGTTTTAGTGG + Intergenic
1194341115 X:92706602-92706624 CCCCGCCTCTCAGGTTCAAGCGG - Intergenic
1195049002 X:101079933-101079955 GCCCAGCCCCCAGGTTGCAGAGG - Intronic
1195112458 X:101661122-101661144 TCCCTCCCCCAAGTTCCCAGAGG + Intergenic
1195444152 X:104932074-104932096 CCCTGCCTCCCAGGTTCAAGTGG + Intronic
1196320815 X:114338196-114338218 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1196676441 X:118425561-118425583 CTCCACCTCCCAGGTTCAAGTGG - Intronic
1196714868 X:118800869-118800891 CTCCACCTCCCAGGTTCAAGCGG + Intergenic
1196917374 X:120551280-120551302 CCTCTGCCTCCAGGTTCCAGTGG + Intronic
1197082971 X:122440945-122440967 CCCATGGCCCCAGGTGCCAGTGG - Intergenic
1197808451 X:130419085-130419107 CCCCTGCCCCCAAGTGCCACGGG - Intergenic
1198180997 X:134209026-134209048 CTCCACCTCCCAGGTTCAAGTGG - Intergenic
1199231846 X:145445411-145445433 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic
1199255874 X:145718363-145718385 CTCCGCCTCCCAGGTTCAAGCGG + Intergenic
1199362751 X:146942465-146942487 CACCTCCCCCCATGTTTCTGAGG - Intergenic
1199936125 X:152575250-152575272 CCCCTCCCCCCAAACTCCATTGG - Intergenic
1200107597 X:153723825-153723847 CACCTCCCTCGAGGATCCAGCGG + Exonic
1200281169 X:154778200-154778222 CTCCACCTCCCAGGTTCCAGGGG - Intergenic
1201315557 Y:12642225-12642247 CTCCGCCTCCCAGGTTCAAGTGG + Intergenic