ID: 1006082470

View in Genome Browser
Species Human (GRCh38)
Location 6:31575356-31575378
Sequence TTGGGGACACACAAGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006082470_1006082483 25 Left 1006082470 6:31575356-31575378 CCTTGATGCTTGTGTGTCCCCAA 0: 1
1: 0
2: 2
3: 12
4: 173
Right 1006082483 6:31575404-31575426 GGAGAAGAAACCGAGACAGAAGG 0: 1
1: 0
2: 3
3: 42
4: 460
1006082470_1006082475 4 Left 1006082470 6:31575356-31575378 CCTTGATGCTTGTGTGTCCCCAA 0: 1
1: 0
2: 2
3: 12
4: 173
Right 1006082475 6:31575383-31575405 CCAAATCCCCGCCCCCGCGATGG 0: 1
1: 0
2: 1
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006082470 Original CRISPR TTGGGGACACACAAGCATCA AGG (reversed) Intergenic
903031642 1:20467917-20467939 TTTTAGACACAGAAGCATCAAGG + Intergenic
905237150 1:36558066-36558088 TGGGGGACACACCATCAACAGGG - Intergenic
905902265 1:41589423-41589445 TTGGAGCCACAAAAGCCTCAGGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906790200 1:48652498-48652520 TGGTGGACACACAGGCAGCAGGG + Intronic
908151498 1:61307154-61307176 TTGGGGGGACACAAACATTAAGG - Intronic
910194226 1:84624048-84624070 GTGGGGACACAGAAGCAGCTGGG + Intergenic
913655985 1:120960149-120960171 ATGGGGGGACACAAACATCAGGG - Intergenic
914520542 1:148411381-148411403 ATGGGGGGACACAAACATCAGGG - Intergenic
915217927 1:154352352-154352374 TTGGGGCCTCACCAGCCTCAAGG - Intergenic
915339644 1:155169621-155169643 TAGGGAAGACACTAGCATCAAGG + Intronic
915414710 1:155732529-155732551 TTGGAGACAAAGAAGCATCAAGG - Intronic
916482945 1:165232047-165232069 TTGGGTATACCCAAGCACCATGG - Intronic
923288420 1:232519900-232519922 TTGAGGAAAAACAAACATCAAGG + Intronic
923630501 1:235646570-235646592 TTGGTGACCCACAAACCTCACGG + Intronic
1064328519 10:14372817-14372839 TTGGGGGCACAGAAGGATCCTGG - Intronic
1065779535 10:29154133-29154155 TTGGAGACACACAAGCACAGAGG - Intergenic
1065821020 10:29525782-29525804 TTGGGGATTCACTAGAATCAAGG - Intronic
1067516478 10:46950510-46950532 AAGGGGACACAGGAGCATCAGGG + Intronic
1067645774 10:48101283-48101305 AAGGGGACACAGGAGCATCAGGG - Intergenic
1068175744 10:53455834-53455856 TTGAACACACTCAAGCATCATGG - Intergenic
1069965170 10:72109331-72109353 CTGGGGACACACAAGCCTTTTGG - Intronic
1072694777 10:97595074-97595096 CTGGGGACACATAAGCAACATGG - Intronic
1083827169 11:65210444-65210466 TTGGGGACACTCACGGAACATGG - Exonic
1084487300 11:69456161-69456183 CTGGGGCCAGACAGGCATCAGGG + Intergenic
1088629705 11:111762930-111762952 TTGAGGACACAGAAGAAACAAGG + Intronic
1089487765 11:118860453-118860475 TTGGGGACAGGAAACCATCATGG + Intergenic
1089945097 11:122462218-122462240 TTGGGCAAACACAAGGATCATGG - Intergenic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1090417871 11:126553080-126553102 ATGGGGACATAAAAGCATGAAGG - Intronic
1091323377 11:134667021-134667043 CTGGGGAGACACGAGCATCCAGG - Intergenic
1091408577 12:224282-224304 TTGGGGACACAGGAGCTTGAGGG - Intronic
1092093455 12:5822855-5822877 TTGGGGAGGCCCAAGAATCATGG + Intronic
1092147550 12:6224842-6224864 TTCCGGACACACATGCACCAGGG - Intronic
1093158722 12:15719421-15719443 TTGGTAACATACAAGCTTCAAGG - Intronic
1096678755 12:53241180-53241202 TTGGAGAGACTCAGGCATCAGGG + Intergenic
1096842800 12:54389771-54389793 TGGGGGTCACTCTAGCATCAGGG + Intronic
1096917134 12:55045419-55045441 TTGGGGAGACACGAGCATTTAGG + Intergenic
1097904871 12:64909419-64909441 TTGGGGGCACATAAACCTCAAGG - Intergenic
1097991546 12:65840339-65840361 CTGGGAAGACTCAAGCATCAGGG + Intronic
1098084521 12:66828049-66828071 TTGGGGACTCCCATGCCTCAGGG + Intergenic
1103223381 12:119265770-119265792 TTGGGTACACACAGACATAAAGG + Intergenic
1103347382 12:120260192-120260214 TTGGGGACACACACTCAGGATGG - Intronic
1104573385 12:129944979-129945001 TTGGGGGCAGACAAGGACCAAGG - Intergenic
1104832724 12:131765092-131765114 CTGGGGACACACCACCTTCAAGG - Intronic
1106139415 13:26999259-26999281 TTGAGGACACACAAGGACTATGG + Intergenic
1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG + Intergenic
1115923789 14:38408025-38408047 TAGGCAACACACAAGCATCCAGG + Intergenic
1117833891 14:59781913-59781935 TTGGGGACACACAAACATACAGG - Intronic
1118947068 14:70398447-70398469 TTGGGCACCAACAAGCATGAGGG - Intronic
1120122864 14:80702746-80702768 TTGGAAACACACAAACCTCAGGG - Intronic
1121591674 14:95118384-95118406 CTGGGGACAAGAAAGCATCAGGG - Intronic
1122142122 14:99668714-99668736 GCGGGGACACACAGGGATCAGGG - Intronic
1122864529 14:104597498-104597520 TTGGGGGGACACAAGCACCTGGG - Intronic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1124031588 15:26017132-26017154 TTTGGAAAACACAAGCAACACGG + Intergenic
1124062952 15:26312433-26312455 TTGGGGACCCTCCAGCATGAAGG + Intergenic
1127390376 15:58500417-58500439 TTGTGGACACAAGAGCAACATGG - Intronic
1127770650 15:62227366-62227388 TTGGGGGCAAACAAGCATAGTGG - Intergenic
1127820046 15:62646822-62646844 CTGGGGACAGAGAAGAATCAGGG - Intronic
1127967106 15:63930630-63930652 TTGGGGACGCACAAACATTTGGG - Intronic
1130061149 15:80570959-80570981 GTGGGGACACACACACACCAGGG + Intronic
1131038219 15:89239649-89239671 AAGGGAACACAGAAGCATCAGGG - Intergenic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131577715 15:93608372-93608394 TGGGGGGCAGACAAGCAGCAAGG - Intergenic
1132046615 15:98568063-98568085 TTGCCCACACACAAGCATCTGGG + Intergenic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1133165859 16:3946842-3946864 TTGGGGACACCCCTGCAGCAGGG + Intergenic
1135591745 16:23710179-23710201 TTGGGGACCCAAAAACAACAGGG - Exonic
1136125807 16:28179549-28179571 TGGAGGAAACAGAAGCATCAAGG - Intronic
1136616533 16:31401834-31401856 TAGGGGTGCCACAAGCATCAAGG - Intronic
1138615548 16:58162736-58162758 TTGGGGACTCAGGAGCAACATGG - Intronic
1143328789 17:6119187-6119209 TGGGGGGCATACAAGCATCTGGG + Intronic
1143924883 17:10360833-10360855 TTGGAGACACACAAGCACATGGG + Intronic
1145971245 17:28957670-28957692 GGGGGGACACACTAGCATAATGG - Intronic
1152637406 17:81435763-81435785 CCGGGGACACACAGGCATCCTGG - Intronic
1152637429 17:81435835-81435857 CCGGGGACACACAGGCATCCTGG - Intronic
1153225087 18:2893891-2893913 TGGGAGACACACAGTCATCATGG - Intronic
1153672753 18:7428112-7428134 TTGGGCACACAGAAGCATGGGGG + Intergenic
1156407905 18:36800065-36800087 TTTGGGACACACAAGGAACCTGG + Intronic
1157280703 18:46344795-46344817 TTGGGGACACACACACCTCTGGG - Intronic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1160223294 18:76992660-76992682 TTCGGGAAACAGAAGCAACATGG + Intronic
1160786321 19:901585-901607 TTGGGGACCCCCAGGCACCATGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1161744015 19:6043712-6043734 TTGGGGACACTCTAGAAGCATGG - Intronic
1168322575 19:55518683-55518705 TTGGGGCCACACATGGACCATGG - Exonic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925030911 2:649347-649369 TAGGAGAGACACAAGCATGATGG + Intergenic
930498771 2:52183985-52184007 TTGAGGAAAAACAAGCATTAAGG - Intergenic
931869500 2:66443764-66443786 TTGTGGACATATCAGCATCAGGG + Intronic
932043398 2:68322925-68322947 TTGGGGGAACACAAGCAGCTGGG - Intergenic
933638648 2:84735092-84735114 TTGGGTACACACAGACATAAAGG - Intronic
937891735 2:126944320-126944342 TTGGGGAAAAACAAGCTGCAAGG + Intergenic
940766718 2:157797789-157797811 TTGGGGAGACACAAACATTCAGG - Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
943441256 2:187931297-187931319 TTGGGGTTACAAAAGCAACAGGG - Intergenic
946027699 2:216681756-216681778 TGGGGGACACAGAAGCATGGTGG + Intronic
946929388 2:224657065-224657087 TTGTGGACACACCAGCACTATGG + Intergenic
947437448 2:230084736-230084758 CTGGGGACATGCAAGCATCTGGG - Intergenic
947790692 2:232866665-232866687 TTTGGGACACACATGCACAAAGG + Intronic
1173371892 20:42443932-42443954 TGGTGGGCACACAAGCATCCTGG - Intronic
1175837499 20:62005408-62005430 TTAGTCACACACAAGCAGCATGG - Intronic
1176388790 21:6152842-6152864 TCAGGGACACACAAACACCAGGG + Intergenic
1177937697 21:27369492-27369514 CTGGGGACACACAATTTTCAAGG + Intergenic
1178875926 21:36413848-36413870 TTGGGGGCTCACAACCAGCAGGG - Intronic
1179208705 21:39307922-39307944 TTGGGGACACTTAATGATCATGG + Intronic
1179734682 21:43385406-43385428 TCAGGGACACACAAACACCAGGG - Intergenic
1180092062 21:45538347-45538369 TTGGGGCCACACTAGACTCATGG + Intronic
1181887683 22:26034553-26034575 TTGGAGCCACAGAGGCATCAGGG - Intergenic
1182519800 22:30878882-30878904 TTGGGGACACTCCAGCTGCAAGG + Intronic
1184109066 22:42384586-42384608 TGGGGGACAGACAAGGATGATGG - Exonic
951260136 3:20497432-20497454 TTGGGTACACACAAACATGAAGG - Intergenic
953061617 3:39432893-39432915 TTAGGGACACAGGATCATCATGG + Intergenic
955631307 3:60978387-60978409 TTAGGGAAACCCAAGCCTCAGGG + Intronic
961755968 3:129127607-129127629 TTGGGCACAGACAAGTAGCAAGG + Intronic
962288058 3:134105228-134105250 TGGAGGACACAGAAGCAACAAGG - Intronic
962405025 3:135093225-135093247 TTGGGGACACAGAGACATGATGG + Intronic
962902377 3:139772578-139772600 TGGGGGACAGAGAAGCAACAAGG + Intergenic
964285454 3:155113013-155113035 TTGGAGTCACAGAAGCATCAGGG + Intronic
966247610 3:177826238-177826260 TGGGGCCCACAGAAGCATCAGGG - Intergenic
971700283 4:29964103-29964125 TTGAGGACACACCAGGTTCAGGG - Intergenic
973978757 4:56288417-56288439 TTGGGAACACACAGACATTAGGG - Intronic
975559588 4:75696495-75696517 ATGGGGTCAAAAAAGCATCATGG + Intronic
976441018 4:85074509-85074531 TTGAGGACACAAAAGGATCTGGG - Intergenic
979761666 4:124413605-124413627 TTGGGGGCACACAAACATTCAGG - Intergenic
980085653 4:128387471-128387493 TGGGGGACACAGTAGCAGCATGG + Intergenic
980436325 4:132778579-132778601 TTGGTGACACATTAGCATAAAGG + Intergenic
981757707 4:148159178-148159200 TTGAGTACCCATAAGCATCATGG - Intronic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
984567714 4:181350631-181350653 TTGTGAACACACAAGGATAAGGG + Intergenic
987588637 5:19892965-19892987 TTGGGGAGACAAAAGCATTTAGG - Intronic
988663948 5:33304399-33304421 ATGGGTTCACACAAGCTTCAGGG - Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
1001860676 5:175052001-175052023 TAGGGGACACACTACCATCAGGG + Intergenic
1002449504 5:179310798-179310820 CTGGGGACGCAGAGGCATCAGGG + Intronic
1002961704 6:1921406-1921428 TTGGGGACACAGCAGCTTCTGGG + Intronic
1004068758 6:12277263-12277285 TTGAAGAGACACAAGCGTCAAGG + Intergenic
1005847739 6:29794205-29794227 TTGGGGTCACACTTGCATCGTGG + Intergenic
1005921288 6:30404240-30404262 GTGGGGAGACATAAGCATGAAGG + Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1006436180 6:34027193-34027215 AGGGGGACACACAGGCATCAGGG + Intronic
1007228844 6:40334098-40334120 TTGAGGACACTGAAGCATCAGGG + Intergenic
1007807985 6:44465027-44465049 TGGGGGAAACAGAATCATCAGGG + Intergenic
1012862244 6:104573744-104573766 ATGGGGAGACACAAGCACTATGG + Intergenic
1013943246 6:115691448-115691470 TTGGAGACAGACAAGCATGAAGG + Intergenic
1014948151 6:127520307-127520329 CTGGGGACACTCAAGCATACTGG + Intronic
1015657300 6:135533228-135533250 TTGGAGAAAAACAAACATCATGG + Intergenic
1015746692 6:136517379-136517401 TTTGGCACAGACAAGCATGATGG + Intronic
1015868218 6:137749498-137749520 TTGTGCAAACATAAGCATCAAGG + Intergenic
1017228058 6:152042877-152042899 GTGGTGGCACTCAAGCATCAAGG - Intronic
1018051473 6:160012689-160012711 GTGGGGACACACAGTCATCCTGG + Intronic
1018848605 6:167572196-167572218 TCAGGGGCACACAAGCAGCAGGG - Intergenic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1019881052 7:3861493-3861515 TTGGTGGCACCCAAGCAGCAGGG - Intronic
1022385927 7:29899102-29899124 TTGGTGCCACACAAGCTTCCTGG + Intronic
1022664225 7:32395197-32395219 ATGGGGAGAAACAAACATCAAGG + Intergenic
1023573814 7:41603043-41603065 TTGTGGAGAAATAAGCATCATGG - Intergenic
1033368647 7:140689967-140689989 TTGGGGACAGCCAAGCATACAGG + Intronic
1033937767 7:146609043-146609065 TTGGAGACACTCAAGGATTATGG + Intronic
1036664100 8:10727772-10727794 TTCAGGACACATTAGCATCATGG - Intronic
1036718443 8:11149066-11149088 TTGGGGGCACACAAACATTCAGG - Intronic
1038026722 8:23597355-23597377 TTGGGGAGACACAAACATTCAGG + Intergenic
1039069953 8:33640758-33640780 TTGGGGAGACCCAGACATCATGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041811774 8:61919385-61919407 TGGGGGACACTCAGCCATCAGGG + Intergenic
1045944608 8:107781428-107781450 TTGGAGGCAGATAAGCATCAAGG + Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1050889262 9:10803212-10803234 CTAGGGACACACAAGTATAACGG - Intergenic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1051631998 9:19149063-19149085 GTGGGGACGCACAAGCAGAAGGG + Intronic
1052315549 9:27112912-27112934 TTGGGGATACACAAAAGTCATGG + Intronic
1056617527 9:88181098-88181120 CTGGGGCCACACAAACAACAAGG - Intergenic
1056972550 9:91219174-91219196 TGGTGGCCACAGAAGCATCATGG + Intronic
1058677125 9:107409922-107409944 TTGGGGACACAAAGGCTTCCAGG - Intergenic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1188848388 X:35102383-35102405 ATGGGGACACACTCACATCAAGG + Intergenic
1189919010 X:45885224-45885246 TGGGGGACACACAAGTATCAGGG - Intergenic
1191005137 X:55703103-55703125 ATCAGGATACACAAGCATCAGGG - Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1193979853 X:88168885-88168907 TTGGTGGCACACATGCATAAGGG - Intergenic
1194690186 X:96974725-96974747 TTGGGGGCATAGAATCATCAAGG + Intronic
1195257833 X:103106271-103106293 TTCTGGACACACTAGCATAAAGG - Intergenic
1195590367 X:106617855-106617877 TTGGAGACAAATAAGCATCCCGG + Intronic
1196548555 X:116995009-116995031 TTGAGATCACAGAAGCATCATGG - Intergenic
1198620095 X:138498511-138498533 TTGGAGAGACACATGTATCATGG + Intergenic