ID: 1006085134

View in Genome Browser
Species Human (GRCh38)
Location 6:31589839-31589861
Sequence CAGCATCTACGTGTGCAGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006085134_1006085143 28 Left 1006085134 6:31589839-31589861 CCACTCTGCACACGTAGATGCTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1006085143 6:31589890-31589912 GCAGCTCAGCCTGGTGGTCATGG 0: 1
1: 1
2: 3
3: 55
4: 407
1006085134_1006085142 22 Left 1006085134 6:31589839-31589861 CCACTCTGCACACGTAGATGCTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1006085142 6:31589884-31589906 GGATGTGCAGCTCAGCCTGGTGG 0: 1
1: 0
2: 0
3: 28
4: 288
1006085134_1006085140 19 Left 1006085134 6:31589839-31589861 CCACTCTGCACACGTAGATGCTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1006085140 6:31589881-31589903 CCCGGATGTGCAGCTCAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 172
1006085134_1006085137 1 Left 1006085134 6:31589839-31589861 CCACTCTGCACACGTAGATGCTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1006085137 6:31589863-31589885 CGTCATGGCCTCGCACGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006085134 Original CRISPR CAGCATCTACGTGTGCAGAG TGG (reversed) Exonic
900497820 1:2984252-2984274 CAGCATCTGCGTGTGCCAGGAGG - Intergenic
901762641 1:11480526-11480548 CAGCAACCTCGAGTGCAGAGCGG - Intronic
905262580 1:36730052-36730074 CATCATGTATGTGTGCACAGTGG - Intergenic
909984204 1:82140636-82140658 CAGCATCAACCTGTGAAGACTGG - Intergenic
917759849 1:178144187-178144209 CGGAATCTATCTGTGCAGAGAGG - Intronic
920062576 1:203237848-203237870 CAGAATCCACGTGGCCAGAGAGG - Intronic
1062934467 10:1375465-1375487 CTTCATCTAAGGGTGCAGAGCGG - Intronic
1063960453 10:11301607-11301629 CAGCTCCCACCTGTGCAGAGTGG + Intronic
1065034769 10:21626422-21626444 AAGCAGGTACGTGTGCAGAACGG + Intronic
1068135319 10:52947388-52947410 CAGCATCTACTTGTTGAGATAGG + Intergenic
1070827080 10:79397589-79397611 AAGCATCTACGTCTTCAGAGGGG + Intronic
1080109715 11:28552427-28552449 CAGCATGTACGTTTGCTGATGGG + Intergenic
1080368961 11:31611848-31611870 CAGAAGCTAAGTGGGCAGAGAGG + Intronic
1080597561 11:33787966-33787988 CAGCATCCACTTGTACACAGTGG + Intergenic
1082299976 11:50493672-50493694 CAGCGTCTATGTGTGAAGAATGG + Intergenic
1083612808 11:64012175-64012197 CAGCATTTAGGGGTGCGGAGCGG - Intronic
1085050519 11:73377719-73377741 CAGCACCTCAGTGTGCAGATGGG - Intronic
1089066509 11:115666027-115666049 CAGCTTCTAAGTGTGCATTGAGG - Intergenic
1093433326 12:19107919-19107941 CAGCGTCTACTTCTGCAGCGTGG - Intergenic
1096487573 12:51994117-51994139 CAGGAGCTCCGTGTGGAGAGAGG - Exonic
1102629231 12:114262742-114262764 AAGCATCTGTGTGTGGAGAGTGG + Intergenic
1104669755 12:130672510-130672532 CAGTATCTCCTTTTGCAGAGGGG + Intronic
1105388089 13:19950612-19950634 CAGCTGCTACGTGGTCAGAGAGG - Intergenic
1105620883 13:22065038-22065060 CAGAATCTGCCTGTGCAGGGAGG + Intergenic
1108584760 13:51861191-51861213 CAGCTGCTACGTGTGGGGAGTGG + Intergenic
1112479065 13:99757292-99757314 CAGCATCTACTTGTACATAATGG + Intronic
1112676249 13:101705506-101705528 GAGCATGAACGTGTGCAGACTGG - Intronic
1116196545 14:41734534-41734556 CAGTCTCTGTGTGTGCAGAGAGG + Intronic
1119558497 14:75571458-75571480 CAGCATCTACATGTCCAGCTAGG + Intergenic
1121554932 14:94829283-94829305 CACCAGGTACGTGAGCAGAGAGG + Intergenic
1122793645 14:104194993-104195015 GAGGGTCTGCGTGTGCAGAGTGG - Intergenic
1124921252 15:34029067-34029089 TAGCATGAACGTCTGCAGAGGGG - Intronic
1129234361 15:74214848-74214870 CAGCTTCTACTTATGCAGAAAGG - Intergenic
1129427642 15:75475763-75475785 CATCATCCACTTCTGCAGAGAGG - Intronic
1132829131 16:1918901-1918923 CAGCACCCTAGTGTGCAGAGAGG + Intergenic
1134063101 16:11210789-11210811 CAGCACCTGGGTGTGCAGCGTGG + Intergenic
1134805056 16:17117450-17117472 CATCATCTCCGTGTGCAGGTAGG + Intronic
1138377051 16:56571456-56571478 CAGCATCTCCATCTGCAAAGTGG - Intergenic
1143124666 17:4634018-4634040 CAGCATCTACTTGTGGACAGAGG + Intronic
1144594099 17:16551875-16551897 CAGCATCAACGTGTTCATACAGG - Exonic
1144812811 17:18011567-18011589 CAGCATCTTCTTGGGCACAGAGG - Intronic
1145797143 17:27662275-27662297 CAGCACCTGGGGGTGCAGAGTGG + Intergenic
1145811539 17:27767216-27767238 CAGCACCTGGGGGTGCAGAGTGG + Intronic
1150929179 17:69565673-69565695 CAGCATGTAGGGGTGGAGAGGGG + Intergenic
1161837417 19:6657424-6657446 CAGCATCTACTTGTTGAGACAGG + Intergenic
1162057065 19:8071240-8071262 CCCCATCAAGGTGTGCAGAGAGG - Intronic
1162579171 19:11517884-11517906 CTGCATCTACTTGTGAAGATGGG - Intronic
1165252718 19:34553720-34553742 CAGCATCTACTTGTTGAGACAGG + Intergenic
1165273065 19:34726725-34726747 CAGCATCTACTTGTTGAGATAGG - Intergenic
925285623 2:2713864-2713886 TAGCACGTGCGTGTGCAGAGTGG - Intergenic
926916736 2:17899603-17899625 CAGTATCCTCGTTTGCAGAGTGG + Intronic
930061271 2:47290942-47290964 CAGGATATACCTGTGCAAAGTGG - Intergenic
931644591 2:64410402-64410424 CAGAAGCTACATGTGCTGAGAGG + Intergenic
932086628 2:68768318-68768340 CTGCATCCACTTGAGCAGAGTGG - Intronic
932259036 2:70311482-70311504 TAACAACTAGGTGTGCAGAGGGG + Intergenic
934614209 2:95761314-95761336 CAGCACTTACGTGGGCAGAGAGG - Intergenic
936941464 2:117888699-117888721 CATCAGACACGTGTGCAGAGGGG + Intergenic
947717364 2:232348593-232348615 AAGCACCAACGTGTGCAAAGTGG - Intergenic
947826278 2:233107896-233107918 CAGAATCTCAGTGTGCAGAAGGG - Intronic
1172525667 20:35599577-35599599 CAGCAACTGCGTGCGCAAAGTGG - Intergenic
1172565417 20:35926676-35926698 CAGAATCAATGTGGGCAGAGCGG - Intronic
1173122360 20:40305543-40305565 TGGCATCAATGTGTGCAGAGAGG - Intergenic
1175177463 20:57120832-57120854 CAGGATGAACGTGTGCAGGGAGG - Intergenic
1175402665 20:58709353-58709375 CAGCATCCACGTGTCCACACTGG + Intronic
1180934422 22:19615374-19615396 CAGCTTCGACGGGAGCAGAGAGG - Intergenic
1182421653 22:30251378-30251400 CAGCATCCTCATTTGCAGAGGGG - Intergenic
1184438716 22:44496191-44496213 CTGCATATTCATGTGCAGAGTGG + Exonic
1184452622 22:44591907-44591929 CTGCATCTGGGTGTGCAGATGGG + Intergenic
1185309820 22:50148066-50148088 CAGCATCTAGGGTTGGAGAGGGG + Intronic
951150302 3:19280895-19280917 CAGCATCAACGAGTTCAAAGAGG + Intronic
951260008 3:20496135-20496157 CAGCACCTGCATGTGGAGAGAGG - Intergenic
954377500 3:50202909-50202931 CAGCAGGAACGTGTGCAGCGTGG + Intergenic
955711880 3:61788158-61788180 CAGCATCAACGTGTGCTGCATGG + Intronic
956413562 3:69003709-69003731 TAGCATCTACCTTTGGAGAGGGG + Intronic
957854789 3:85860607-85860629 CACCATCTTCTTGTGTAGAGAGG + Intronic
959064259 3:101641005-101641027 CAGCATCTACTTGTTGAGATAGG - Intergenic
960372157 3:116853822-116853844 CAGTTTCTACATGTGCAAAGTGG - Intronic
963702141 3:148639673-148639695 CTGCATCTACGAGGGCAGCGAGG + Intergenic
964306215 3:155343044-155343066 CAGCATCCAGGTGTGAAGCGGGG + Intergenic
964391831 3:156205953-156205975 CAGCATGTACAAGTGCACAGAGG - Intronic
969651720 4:8471911-8471933 CAGCTTCCAGGTGTGCACAGAGG + Intronic
970600331 4:17636867-17636889 CAGCATCTATGTGCACACAGGGG - Intronic
972670545 4:41210850-41210872 GAGCATCTACCTTTTCAGAGGGG + Intronic
974086990 4:57272309-57272331 CAGCTTCCTCATGTGCAGAGTGG + Intergenic
974384808 4:61190408-61190430 CATCATCTACATGTGAGGAGTGG + Intergenic
975909309 4:79248673-79248695 CAGCATGAACATGTGCATAGAGG + Intronic
976673946 4:87683955-87683977 CACCATCTACCTGTGCACTGGGG + Intergenic
978882626 4:113725315-113725337 CAGCAACTATTTTTGCAGAGTGG + Intronic
979790028 4:124768184-124768206 CAGCATCTGCTTCTGCGGAGGGG + Intergenic
986599471 5:9457312-9457334 CAATTTCTACCTGTGCAGAGTGG + Intronic
988043656 5:25919712-25919734 GAGCATCCAAGTGTGAAGAGAGG + Intergenic
989177698 5:38544703-38544725 CAGCATCTAGGTGGGGAGGGAGG - Intronic
994125495 5:96165307-96165329 GAGGATATATGTGTGCAGAGGGG + Intergenic
994285322 5:97957579-97957601 CAGCACCTAAGTGGGCAGAGAGG - Intergenic
995754592 5:115489600-115489622 CACCATCTTGGTGGGCAGAGAGG - Intergenic
998107716 5:139478812-139478834 CAGCATTCTCGTGTGCACAGAGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1001322812 5:170696989-170697011 CAGATTCTACGTGTACAGGGAGG - Intronic
1003525520 6:6893541-6893563 CAGCCTCTGCGTCTGCAGAGAGG + Intergenic
1004131608 6:12926097-12926119 CAGCATTTAGGAGTTCAGAGGGG - Intronic
1005810402 6:29510974-29510996 CACAATCTGAGTGTGCAGAGTGG + Intergenic
1006085134 6:31589839-31589861 CAGCATCTACGTGTGCAGAGTGG - Exonic
1007254580 6:40519976-40519998 CAGCATATACAAGAGCAGAGTGG + Intronic
1009469400 6:64013471-64013493 CATCATCAACATGTTCAGAGAGG - Intronic
1011315994 6:86031953-86031975 CAGCATCTACGAGGACAGAGAGG - Intergenic
1013296347 6:108761398-108761420 CAGCATCTAAGTGGGTACAGAGG - Intergenic
1015039403 6:128698652-128698674 CAGTATCGGCGTGTTCAGAGTGG - Intergenic
1015820265 6:137253236-137253258 TAGCATCTATCTCTGCAGAGTGG + Intergenic
1019103075 6:169647787-169647809 CAGCATACACGTGTGCAGGTGGG + Exonic
1019788643 7:2996129-2996151 CAGCATGGGCGTGTGCACAGAGG - Intronic
1024471963 7:49774546-49774568 CAGCACCAAGGTGTGCAGTGCGG - Intronic
1024929508 7:54655340-54655362 CAGCATTTAAGAGTGCAGAGAGG - Intergenic
1030820340 7:114085653-114085675 CAGCAGCTCCGTCTGCTGAGAGG + Intergenic
1032013248 7:128360276-128360298 CAGCTTCTGCATGAGCAGAGGGG - Intronic
1038450568 8:27636645-27636667 CAGCCTCTTCATGTGCCGAGCGG + Intronic
1041568956 8:59313905-59313927 CAGTATCTATGTGTGAAGAATGG - Intergenic
1043392011 8:79800950-79800972 GAGGCTCTAGGTGTGCAGAGAGG + Intergenic
1045669980 8:104540016-104540038 TAGAATCAAAGTGTGCAGAGTGG + Intronic
1053019877 9:34687449-34687471 CTGGATCTCCGGGTGCAGAGTGG + Intergenic
1053333854 9:37245489-37245511 GAGCACCTACCTGTGCAGAGTGG + Intronic
1057233107 9:93337008-93337030 CAGCACCTAAGTGTTCTGAGAGG - Intronic
1057252408 9:93514632-93514654 CAGCACCTAAGTGTTCTGAGAGG + Intronic
1062392275 9:136338542-136338564 CAGCGTCTTCCTGTGCAGAGTGG - Exonic
1186067558 X:5782621-5782643 CTGCATCTACGTGAGCACGGGGG - Intergenic
1194774416 X:97944697-97944719 CAGCATGAACATGTGCACAGAGG + Intergenic
1199298873 X:146189474-146189496 CAGCATCTATGTGTTGAGAAGGG + Intergenic
1201319997 Y:12687961-12687983 ATGCATCTAAGTGAGCAGAGGGG - Intergenic