ID: 1006085552

View in Genome Browser
Species Human (GRCh38)
Location 6:31592634-31592656
Sequence CCTCCCACCCACACTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 382}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006085544_1006085552 -3 Left 1006085544 6:31592614-31592636 CCAGCCTCCTGGATCTCCCTCCT 0: 1
1: 0
2: 7
3: 89
4: 808
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085537_1006085552 27 Left 1006085537 6:31592584-31592606 CCACCAAGCCCGTTCCCTATAGC 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085546_1006085552 -10 Left 1006085546 6:31592621-31592643 CCTGGATCTCCCTCCTCCCACCC 0: 1
1: 3
2: 16
3: 125
4: 942
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085542_1006085552 12 Left 1006085542 6:31592599-31592621 CCTATAGCATCTAGTCCAGCCTC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085540_1006085552 18 Left 1006085540 6:31592593-31592615 CCGTTCCCTATAGCATCTAGTCC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085545_1006085552 -7 Left 1006085545 6:31592618-31592640 CCTCCTGGATCTCCCTCCTCCCA 0: 1
1: 0
2: 4
3: 80
4: 700
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085534_1006085552 30 Left 1006085534 6:31592581-31592603 CCCCCACCAAGCCCGTTCCCTAT 0: 1
1: 0
2: 0
3: 3
4: 129
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085538_1006085552 24 Left 1006085538 6:31592587-31592609 CCAAGCCCGTTCCCTATAGCATC 0: 1
1: 0
2: 1
3: 4
4: 54
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085541_1006085552 13 Left 1006085541 6:31592598-31592620 CCCTATAGCATCTAGTCCAGCCT 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085536_1006085552 28 Left 1006085536 6:31592583-31592605 CCCACCAAGCCCGTTCCCTATAG 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085535_1006085552 29 Left 1006085535 6:31592582-31592604 CCCCACCAAGCCCGTTCCCTATA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382
1006085539_1006085552 19 Left 1006085539 6:31592592-31592614 CCCGTTCCCTATAGCATCTAGTC 0: 1
1: 0
2: 1
3: 1
4: 58
Right 1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG 0: 1
1: 1
2: 3
3: 51
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006085552 Original CRISPR CCTCCCACCCACACTCCTTG GGG Intronic
900174701 1:1286551-1286573 CCTCCCACCTTCCCTCCTTCTGG - Intronic
900657144 1:3764012-3764034 CCAGCCTCCCACACACCTTGGGG - Intronic
900708323 1:4094404-4094426 CCTCCCACCCCCACGGCCTGCGG - Intergenic
900760505 1:4467184-4467206 TCTCCCACCAAAACTCCATGGGG - Intergenic
900907814 1:5573089-5573111 CCTGCCACCCCCACTTCCTGGGG + Intergenic
902208437 1:14887024-14887046 CCTCACAACCACACTCGTGGGGG - Intronic
903187011 1:21634524-21634546 TCTCCCACCCACACCCCCAGGGG - Intronic
903259894 1:22125835-22125857 CCTCCCACCCTCACACCCTTTGG + Intronic
903367977 1:22816576-22816598 CCTCCCACCTGGACCCCTTGCGG + Intronic
903884264 1:26531832-26531854 CCCCCCTCCCCCACTCCTGGAGG + Intronic
904324573 1:29719976-29719998 CTTCCCACATACACTCCCTGGGG + Intergenic
904935572 1:34127487-34127509 CCTCCTCCCCTCACTCCTGGAGG - Intronic
904951174 1:34240226-34240248 CATGCCACCCACCCTCCTGGTGG - Intergenic
904954401 1:34270992-34271014 CACACCAACCACACTCCTTGAGG - Intergenic
904999409 1:34656672-34656694 CCTCCCACAAACCCTCCTTAAGG - Intergenic
906101581 1:43267342-43267364 CCTCCCTCCCTCCCTCCTTCAGG - Intronic
906190986 1:43899372-43899394 CCTCCAACCCAGAGTTCTTGAGG - Intronic
907474594 1:54697387-54697409 CATCCCATCCCCACTTCTTGGGG - Intronic
908717817 1:67088695-67088717 CCACCCATCCACACTCACTGTGG + Intergenic
911056260 1:93710945-93710967 CCTGCCACGCTCACTCATTGTGG + Intronic
912435536 1:109658551-109658573 CCTCCCAACCACCCTCCTCTGGG - Intronic
912449488 1:109760445-109760467 CCTTCCACCCAGGCTTCTTGTGG + Intronic
912633635 1:111270920-111270942 CCTCACACCCACACAGCCTGCGG + Intergenic
913216946 1:116628572-116628594 CCTGCCACCCACACTCTTGGTGG - Intronic
915299192 1:154942313-154942335 CCTCCTTCCCACAGGCCTTGGGG - Intergenic
915561712 1:156691806-156691828 GCTCCCACCCCCGCTGCTTGAGG - Intergenic
916038587 1:160943094-160943116 CCTTCCACCACCACTCATTGCGG + Intergenic
916627227 1:166571531-166571553 ACTACCATGCACACTCCTTGAGG - Intergenic
919262762 1:195218747-195218769 CACCCCACACTCACTCCTTGGGG + Intergenic
920036935 1:203072183-203072205 CCACACACCCACACTCCTGGAGG - Intronic
920250157 1:204618007-204618029 CCTCCCACCCACACCCTTCCTGG + Exonic
920250766 1:204620919-204620941 CCTCCCACCTACACTGCCAGAGG - Exonic
921192108 1:212719613-212719635 CCTCCCTCCCCTACTCCTTTTGG + Intergenic
923652631 1:235888348-235888370 CCTCCAACCTACCATCCTTGAGG + Intergenic
923686228 1:236155511-236155533 CCTCCCACCCACACCCTTTGCGG - Intronic
923714067 1:236410241-236410263 CCTCCCACCCTCCCCCCTTTTGG + Intronic
1063091104 10:2866835-2866857 CCTCCCACCCACACAGCGAGAGG + Intergenic
1063322883 10:5068690-5068712 CCTGCCACCCCCTCTCCATGGGG - Intronic
1063664005 10:8051143-8051165 CCTCCCACCCGCCCTCCCAGGGG - Intergenic
1063966582 10:11350989-11351011 CCTCCAACCCACAATCCTAGAGG + Intergenic
1064212998 10:13376482-13376504 CCTCCCTCCTACACACCTGGAGG - Intergenic
1064992271 10:21266538-21266560 CCCCACACCCACACTGCATGAGG + Intergenic
1065534010 10:26700252-26700274 CCTCCCCCCCACCCCGCTTGAGG + Intronic
1065592309 10:27276916-27276938 CCTCCCACCCTCCATCCTTAAGG - Intergenic
1066753773 10:38688445-38688467 CCTCCAACCCTCTCTCCTTTTGG - Intergenic
1067757143 10:49013749-49013771 GCTCCCACCCTCACTCCTGCTGG - Intergenic
1067965647 10:50909834-50909856 CCTCCCTCCCAATCTGCTTGTGG + Intergenic
1068206149 10:53856945-53856967 CCTCCCATCCTCCCTCCTTTTGG - Intronic
1070872726 10:79771920-79771942 CCTCTCACCCACCCTCCTCTTGG + Intergenic
1071639649 10:87294069-87294091 CCTCTCACCCACCCTCCTCTTGG + Intergenic
1071655586 10:87443883-87443905 CCTCTCACCCACCCTCCTCTTGG - Intergenic
1074717504 10:116233570-116233592 CCTCCCCAACACTCTCCTTGTGG + Intronic
1074933679 10:118156686-118156708 CCTCCTACCCTCTCTCCTTTTGG - Intergenic
1074992119 10:118718311-118718333 CCTGCCCCCCACACACCCTGTGG - Intronic
1075617902 10:123904873-123904895 CATCCCACCCACCCACCTGGAGG + Intronic
1076788949 10:132766859-132766881 GCTCCCACCCAGGCTCCCTGAGG - Intronic
1076788975 10:132766938-132766960 ACTCCCACCCAAGCTCCCTGAGG - Intronic
1076789011 10:132767072-132767094 GCTCCCACCCAAGCTCCCTGAGG - Intronic
1076789030 10:132767140-132767162 GCTCCCACCCAAGCTCCCTGAGG - Intronic
1076789059 10:132767243-132767265 GCTCCCACCCAAGCTCCCTGAGG - Intronic
1076824212 10:132959164-132959186 CCTCCCTCCCTCAGTCCTTGTGG + Intergenic
1077548296 11:3186539-3186561 CCTCCCACCCTCCCTCCTTTTGG + Intergenic
1077786703 11:5391707-5391729 CCTCCCACCCATTCTCCTACAGG + Intronic
1078986357 11:16603518-16603540 CCTCCCACCCCCACTCCCAAAGG - Intronic
1080046296 11:27812008-27812030 CTTCTCACCCAGCCTCCTTGGGG - Intergenic
1080606855 11:33870596-33870618 CCTCCCAGCCACCCTCCCTCTGG - Intronic
1080723747 11:34874498-34874520 CCACTCACCCACATCCCTTGAGG - Intronic
1081267390 11:41042478-41042500 CTTTCCACCTACACTCCTTATGG - Intronic
1081307924 11:41536216-41536238 CCTCCCACACACACAGCTAGAGG + Intergenic
1081961254 11:47139285-47139307 ACTCCCACACACACCCCTAGAGG + Intronic
1083277748 11:61606719-61606741 CTTACCTGCCACACTCCTTGAGG - Intergenic
1083490385 11:63011121-63011143 CCCCCAACCCACAATCCGTGAGG - Intronic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1084101888 11:66955296-66955318 CCTCCCACCACCACTCATGGGGG - Intronic
1084166563 11:67377558-67377580 CCAGCCAGCCACACTTCTTGAGG - Intronic
1084411747 11:69009799-69009821 CCTCCCACCCACACCCGTCTGGG + Intronic
1084771122 11:71343541-71343563 GCTCCCATCCACCCTCCCTGCGG + Intergenic
1084935387 11:72584107-72584129 CCTCCGACTGACTCTCCTTGTGG - Intronic
1085697842 11:78721000-78721022 CCTCCCTCCCACAGTTGTTGGGG - Intronic
1086573084 11:88306974-88306996 CCTACCACCCAAACCCCTAGGGG - Intronic
1087049151 11:93868624-93868646 TCTCCCACCCACACTCGCTCAGG - Intergenic
1088555696 11:111058638-111058660 CCTCCCTCCCACATTGCTTCTGG + Intergenic
1088559899 11:111103581-111103603 CCTCCAACCCAGACCCCTGGAGG + Intergenic
1088912348 11:114201224-114201246 CCTCCCACCTCCACTCCCTTTGG - Intronic
1088994399 11:114983996-114984018 CCACCAACCCAAACTCCTTGAGG + Intergenic
1089252110 11:117171955-117171977 CTCTCCACCCACACTCCTGGAGG + Intronic
1089585902 11:119509340-119509362 CCCCCCACCCCCACCCCTTTTGG - Intergenic
1089752279 11:120660374-120660396 CCTGCAGCCCGCACTCCTTGAGG + Exonic
1090768245 11:129895566-129895588 GCGCGCACCCAGACTCCTTGCGG - Intronic
1092292312 12:7168859-7168881 CCTTCAACCCACAATCCTAGAGG - Intergenic
1094048691 12:26195777-26195799 CCTCCTCCCCGCACTCCTTGGGG - Exonic
1094317520 12:29149534-29149556 CCTCACACCCACCCTCCTCGAGG - Intronic
1096675239 12:53222528-53222550 CCTCCCAACCCCCCTCCCTGTGG - Intronic
1097053799 12:56238565-56238587 CCTCCCACCCACCCCCATTTTGG + Exonic
1099326389 12:81220586-81220608 CCTCCCTCCCTCACACCTTTTGG + Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1102417896 12:112780343-112780365 CCTCCCACCCTCCCTGCTTTTGG + Intronic
1102582695 12:113900886-113900908 CATCCCTCCCAAACTCCTTGGGG + Intronic
1103325172 12:120115735-120115757 CCACACACACACACTGCTTGAGG - Intronic
1103983701 12:124753450-124753472 CCTGCCTCCGACACTCCTCGTGG - Intergenic
1104320634 12:127747639-127747661 CCTCCCTCCCTCCCTCCCTGAGG + Intergenic
1104479692 12:129096617-129096639 CCTGCTACCAGCACTCCTTGAGG + Intronic
1104852397 12:131883525-131883547 CAGCCCACCCTCACTCCTGGGGG + Intergenic
1105344198 13:19559448-19559470 GCTCCCACCCAGCCTCCTCGGGG - Intergenic
1106002608 13:25738346-25738368 CCCCCCACACACACTTCTTCTGG + Intronic
1107396684 13:40025292-40025314 CCTCCCAGCATCACTCCCTGGGG - Intergenic
1108524753 13:51277322-51277344 CCTCCCACCCTCCCACCCTGTGG - Intronic
1108848239 13:54700222-54700244 CCACACACACACACACCTTGGGG - Intergenic
1109986943 13:69998965-69998987 ACTCTCACCCACACTTCTAGAGG + Intronic
1110418529 13:75278617-75278639 CTTTCTTCCCACACTCCTTGGGG - Intergenic
1110661643 13:78064598-78064620 CCTCCCTCCCCCACTCCTACAGG + Intergenic
1112379764 13:98877738-98877760 CTTCCCACCTGAACTCCTTGAGG + Intronic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1115274304 14:31590347-31590369 CCTCCCATCCCATCTCCTTGAGG + Intronic
1115464736 14:33702702-33702724 CCTCCCACCCTCTCCCCTTCAGG - Intronic
1116650588 14:47586693-47586715 CCTCACACCCACCCTCCATGAGG + Intronic
1116808814 14:49519892-49519914 CCTCCCTCCCTCCCTCCTTCTGG - Intergenic
1119480425 14:74954929-74954951 CCTCCCTCCCTCCCTCCCTGTGG + Intronic
1120280949 14:82437278-82437300 CCTCCCACCCACAATACATGGGG - Intergenic
1120700832 14:87697223-87697245 CCTCCCACTCACACACCATTGGG + Intergenic
1121515293 14:94545627-94545649 CTTCCCACCCACACACCTTTTGG + Intergenic
1122170218 14:99867077-99867099 CCTCTCTCCCACCCTCCTTTTGG + Intronic
1122924325 14:104892739-104892761 CCCCCCACCATCCCTCCTTGTGG + Intronic
1123062302 14:105599804-105599826 CCTCCCACCGCCTCTCCTGGGGG + Intergenic
1123087044 14:105721532-105721554 CCTCCCACCACCTCTCCTGGGGG + Intergenic
1123880809 15:24676287-24676309 CATCCCAGCCACTCTCCTGGAGG + Exonic
1123973391 15:25529784-25529806 CCTCCCACCCTCCCACCTTTCGG + Intergenic
1124020869 15:25921698-25921720 CCTCCCACCCACCCTCCAAAAGG + Intergenic
1124364240 15:29061052-29061074 CAACTCACCCACACTCCTGGGGG + Intronic
1126533767 15:49738287-49738309 CCTCCCTAACACACTCCATGAGG + Intergenic
1128358147 15:66942879-66942901 CCTCCCACCCATCCTGCTTATGG + Intergenic
1129456832 15:75680567-75680589 GCTCCCACTCCCACTCCTGGGGG - Intronic
1129904281 15:79175117-79175139 CCTCCCAGCCACACACCTCCAGG - Intergenic
1130043301 15:80424210-80424232 TCTCTCACCCACAGTCCTTGCGG - Intronic
1131238457 15:90717419-90717441 CCTCGCACGCAGACTCCTAGCGG - Exonic
1132170293 15:99644825-99644847 CCACCCAACAACCCTCCTTGGGG - Intronic
1132404392 15:101533519-101533541 GCTCCCACCCACACCCCTCACGG + Intergenic
1132980849 16:2738070-2738092 CCTCCCTCCCACAAGCCATGGGG + Intergenic
1133040533 16:3058104-3058126 CCACCCAGCCACACACCCTGGGG + Intronic
1133137327 16:3720995-3721017 CCACCCACCCCCATTCCCTGAGG - Intergenic
1133331977 16:4980517-4980539 CCTCCCTGACACCCTCCTTGAGG + Intronic
1133773618 16:8882169-8882191 TCTCCCACCCACCCACCATGTGG + Intergenic
1133923888 16:10179353-10179375 ACTCCCACCCACTCCCCTTGAGG + Intronic
1134861124 16:17561413-17561435 CATCCCAGCCACTCTCCTGGGGG + Intergenic
1136276367 16:29181431-29181453 GCTCCCACCCACACCCCTGGGGG - Intergenic
1136779460 16:32887217-32887239 CCAACCACACACACCCCTTGAGG - Intergenic
1136891156 16:33974301-33974323 CCAACCACACACACCCCTTGAGG + Intergenic
1137580431 16:49630512-49630534 CCTCCCACCCACCCACCTATAGG - Intronic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1139673343 16:68506588-68506610 CCTCCTTCCCACAGTCCCTGGGG - Intergenic
1140250151 16:73288164-73288186 CCTCCCTCCCTCCCTCCATGGGG - Intergenic
1141064477 16:80902765-80902787 GCTCCCACCCAGCCTCCTGGAGG + Intergenic
1141579114 16:84985141-84985163 CCTCCCACCCAAACACCCAGCGG + Intronic
1142080750 16:88147491-88147513 GCTCCCACCCACACCCCTGGGGG - Intergenic
1142221191 16:88856094-88856116 CCTCCTTCCCTAACTCCTTGTGG - Intronic
1142242238 16:88952859-88952881 CCCCCCACCCCCACACCCTGGGG + Intronic
1203081876 16_KI270728v1_random:1149305-1149327 CCAACCACACACACCCCTTGAGG - Intergenic
1142986303 17:3697110-3697132 CCTCCCTCCCACACTCAGGGCGG + Intergenic
1143026304 17:3943822-3943844 CCTCCCACCTGCTCTCCCTGGGG + Intronic
1143455655 17:7065931-7065953 ACTTCCACCCACGCTCCTTGGGG + Intergenic
1144357934 17:14463397-14463419 TCTCCCTCCACCACTCCTTGAGG - Intergenic
1144624698 17:16838773-16838795 CCTCCCACCCACTCACTTTGTGG + Intergenic
1144684961 17:17220005-17220027 CCTCCCTCCCTCCCTCCTTCTGG + Intronic
1144881732 17:18433948-18433970 CCTCCCACCCACTCACTTTGTGG - Intergenic
1145005766 17:19336882-19336904 CCTCCCACCCCCTTTCCCTGAGG - Intergenic
1145150501 17:20510438-20510460 CCTCCCACCCACTCACTTTGTGG + Intergenic
1146660869 17:34664504-34664526 CCTTCCACCCACACACATGGAGG + Intergenic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1147159325 17:38561421-38561443 CCCCCCACCCCCAGTCCCTGAGG + Intronic
1147242066 17:39097042-39097064 CCTCACAGCCTCACTCCTGGGGG - Intronic
1147422704 17:40330597-40330619 CCTCTCACCCACAGTCCTGAGGG - Intronic
1147578834 17:41617467-41617489 CCCCCCACCCACTCACTTTGTGG + Intergenic
1149393514 17:56215838-56215860 CCTCCCACCCACGCTGCCTCTGG - Intronic
1149660680 17:58332634-58332656 CCTCCCTCCCTCCCTCCCTGGGG + Intergenic
1149702873 17:58669921-58669943 ACTCCATCCCACGCTCCTTGAGG + Intronic
1150815624 17:68389936-68389958 CCCCCCACCTGCACACCTTGGGG + Intronic
1151679000 17:75614187-75614209 CCTCCCACCCAGAGGCCTGGAGG + Intergenic
1152670283 17:81600045-81600067 CCTTCCAGCCACACTTCATGAGG - Intronic
1152694630 17:81737953-81737975 GCTCCCACCCACACTCCAGGTGG - Intergenic
1153950567 18:10054539-10054561 CCACCCCCTCACACTCCTTGTGG + Intergenic
1154977621 18:21474743-21474765 CCTCCCATCCACAGACCTAGAGG - Intronic
1155868180 18:30992573-30992595 ACTCCCACCCATATTCCTTGTGG + Exonic
1157007930 18:43608683-43608705 CCTCCCAACCGCCCTCCTTTTGG + Intergenic
1157077673 18:44483390-44483412 ACTCCCACCCTCACTCCCAGGGG - Intergenic
1157100022 18:44720908-44720930 CCCCCCACCCCAACCCCTTGGGG + Intronic
1157335888 18:46737041-46737063 CCACCCACTCACACTGCATGAGG + Intronic
1157880824 18:51319673-51319695 CCTTCCACCCAGACTACTGGTGG - Intergenic
1159684087 18:71394815-71394837 TCTCCCACCCAGAGACCTTGGGG - Intergenic
1160250865 18:77202576-77202598 CCTCCCACCCACAGCCATGGTGG + Intergenic
1160910287 19:1470872-1470894 CCTCCCACCCCCACCCTTTTGGG - Exonic
1161001958 19:1915049-1915071 CCTCCCGCCCACGCTGCTGGAGG - Intronic
1161120625 19:2523880-2523902 CGTCCCACCCCCACTTTTTGGGG + Intronic
1161127502 19:2566595-2566617 CCTCCCACCCCCACTGCTAAAGG + Intronic
1161307051 19:3574027-3574049 CCGCCCACTTCCACTCCTTGGGG + Intronic
1161701818 19:5800031-5800053 CCTGCCACCCACAGGCCTTGTGG + Intergenic
1161991428 19:7686379-7686401 CCTCTCACCCACCCACCTGGAGG - Exonic
1162345671 19:10116784-10116806 CCTCCCACCCCCACACCTCCCGG + Exonic
1163273400 19:16267616-16267638 CCTCCCATCCAACCTGCTTGTGG - Intergenic
1163634376 19:18431477-18431499 CCTCCCACCCTCAAGCCATGAGG + Intronic
1164574647 19:29398607-29398629 CCTCCCACCCACACTCACCTGGG + Intergenic
1165148719 19:33748937-33748959 CTTCCCAGCCTCACTCCTTGAGG - Intronic
1165749971 19:38253521-38253543 CATCCCACCCACCCACCTTGAGG - Intronic
1166351700 19:42201877-42201899 TCTCCCACCCACATTGATTGAGG - Intronic
1166654905 19:44603877-44603899 GCTCCTAACCTCACTCCTTGTGG - Intergenic
1167502999 19:49857822-49857844 CCTCCCAGCCACAGTCCGTGAGG - Intronic
1168431795 19:56287410-56287432 CCTCCCTCCCACATTGCCTGCGG + Intronic
925385384 2:3458331-3458353 CCTCACTCCCTCACTCCTTGTGG + Intronic
925738328 2:6983610-6983632 CCTCTCACCCACTCTCCTGGAGG + Intronic
926095519 2:10079159-10079181 CCTCTCCCCCACCCTCCCTGGGG + Intronic
926383939 2:12317507-12317529 CCTCACACCCACACTGCTTCTGG - Intergenic
926561620 2:14423899-14423921 CCTCCTGCCCAGACACCTTGTGG + Intergenic
927708248 2:25310326-25310348 CTCCCCACCCACCCTCCATGAGG + Intronic
927798967 2:26079275-26079297 GCTCCTACCCCCACTCCGTGAGG - Intronic
928118223 2:28563362-28563384 CCTGTCACCCACACTCCCTCTGG - Intronic
928396329 2:30945608-30945630 CCTTCCATCCACAGTCCTGGTGG + Intronic
929568764 2:43006699-43006721 CCTGCAGCCCATACTCCTTGAGG - Intergenic
929659926 2:43774045-43774067 CCTCACTCCCAGACTCCTTGCGG + Intronic
929824272 2:45298223-45298245 GCTCCCACCCACATCCCTCGTGG + Intergenic
932715604 2:74099250-74099272 CCTCTCTCCCCCACTGCTTGGGG + Intronic
934516800 2:94993530-94993552 CATCCCACCAGGACTCCTTGTGG - Intergenic
935918747 2:107986686-107986708 CCTCGCACCCACACCCCTCGCGG + Exonic
935920358 2:108006162-108006184 CATCCCAGCCATACTCATTGGGG + Exonic
936646603 2:114379039-114379061 CCTCCCACCCTCACCCCCAGTGG - Intergenic
937099851 2:119260215-119260237 CCTCCCACCCCTCCTCATTGTGG - Intronic
937376171 2:121337207-121337229 AATCCCACCCACGCTCCTGGAGG - Intergenic
939105615 2:137945251-137945273 CCTCCCACCCTGCCCCCTTGGGG - Intergenic
942385772 2:175441243-175441265 CCTCCCAAGCACCCTCCTTGTGG + Intergenic
942421717 2:175814630-175814652 CCTCCCTCCCTCCCTCCTTTTGG - Intergenic
943604034 2:189955094-189955116 CCTCCCACCCTCCCACCTTTTGG + Intronic
945034835 2:205695907-205695929 CCTCCCACCCAGACCACATGAGG - Intronic
946408888 2:219506822-219506844 GCTCCTACCCACTCCCCTTGAGG + Exonic
946900739 2:224369065-224369087 CCTCCCACCAAGACTCCTATGGG + Intergenic
947531473 2:230911446-230911468 CCTCCCACCCACTTTCCTGATGG + Intronic
947701992 2:232242351-232242373 CTCCCCACCCACACTCCCTCAGG - Intronic
947866208 2:233399574-233399596 CCTCCCACGCCCACTCCCTCTGG - Intronic
948364431 2:237445707-237445729 CTCCCCACCCAGACTCCTGGCGG - Intergenic
948481138 2:238251342-238251364 CCTCACACCCTGGCTCCTTGTGG - Intronic
949017824 2:241723413-241723435 CCAGCCAGCCACACTCCTTGAGG - Intronic
1168903835 20:1388730-1388752 CCCCCAACCCACGCTCCTTCTGG - Intronic
1169324406 20:4663599-4663621 CCTTCCACCCTCCCACCTTGTGG + Intergenic
1169689140 20:8310717-8310739 CCTCCCACTCTCCCTCCTTTTGG + Intronic
1170683206 20:18545186-18545208 CCTCCCATCCTCACTGCTTTGGG - Intronic
1171045658 20:21808012-21808034 CCTCCAATCCATTCTCCTTGGGG - Intergenic
1172220776 20:33273370-33273392 CCTCGCTCCCCCACTCCATGGGG + Intergenic
1172277689 20:33688949-33688971 CCTCCGTCCCACAATCCTTCAGG + Intergenic
1173227413 20:41169984-41170006 CCTCCTTCCCACACCCCATGAGG - Intronic
1173822571 20:46028913-46028935 CCCCCCACCCACTCTCCGGGCGG - Intronic
1175408252 20:58749251-58749273 CCAGCCACCCACACCCTTTGAGG - Intergenic
1176267581 20:64218634-64218656 ACTCCCACCCACCCTCCTCTAGG - Intronic
1179288239 21:39996423-39996445 CCTCCAACCCACCCTCCAAGGGG - Intergenic
1179655138 21:42839972-42839994 CCTCCCATCCACCCCCCTGGGGG - Intergenic
1179894014 21:44351346-44351368 GCCCCAACCCACACTCCCTGGGG + Intronic
1180650829 22:17375545-17375567 CCTCCACCCCACTCTACTTGGGG - Intronic
1180818297 22:18806955-18806977 CCTGCCACCCACACTCTTGGTGG - Intergenic
1180879827 22:19195890-19195912 GCTCCCACCCCCACTTCCTGTGG - Intronic
1181204520 22:21241410-21241432 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181756777 22:25029573-25029595 CCGCCCACCCACACACCCTGAGG + Intronic
1182067920 22:27443501-27443523 CCTCCCACCCTCCCTCCTCAAGG + Intergenic
1183642862 22:39102628-39102650 CCTCCCACCCTCTCTTCTTTTGG + Intronic
1183768124 22:39898230-39898252 CATCTCAGCCACACTCCCTGTGG + Intergenic
1183952118 22:41357835-41357857 CCTCCCACCCCCTCCCCCTGGGG + Exonic
1184192345 22:42903235-42903257 CCTCTCACCCACCTTCCCTGGGG + Intronic
1184694488 22:46131881-46131903 CCCCCGACCCACACTCCTGAAGG - Intergenic
1184841006 22:47052401-47052423 CCTCCCACCTCCTCACCTTGAGG - Intronic
1185021635 22:48380023-48380045 GCTCCCACCCACCCTCCTTCTGG - Intergenic
1203222405 22_KI270731v1_random:54005-54027 CCTGCCACCCACACTCTTGGTGG + Intergenic
1203268425 22_KI270734v1_random:32809-32831 CCTGCCACCCACACTCTTGGTGG - Intergenic
949944257 3:9177748-9177770 CCTCCCATTCTTACTCCTTGTGG + Intronic
950977933 3:17269642-17269664 CCTCCCTCCCTCCCTCCTTCTGG + Intronic
953258565 3:41314356-41314378 TTTCCCACCCACCCTCCTTTTGG + Intronic
953410675 3:42688899-42688921 CCTTCCACTCAAACTTCTTGGGG - Exonic
953764253 3:45723108-45723130 CATGCCACCCACACACCTTTTGG - Intronic
953847338 3:46438286-46438308 CCCCCACCCCACACTCCTGGTGG + Intronic
954411893 3:50374438-50374460 CCTGCCCCACACACTCCTGGGGG - Intronic
954766594 3:52923197-52923219 CCCCCCACACACACACCTTTTGG - Intronic
956669492 3:71672927-71672949 CCTTCCACCCCCATGCCTTGTGG - Intergenic
958564942 3:95797582-95797604 CCTCCCATCCACCCTCATTAAGG + Intergenic
959751644 3:109843963-109843985 CTTTCCTCCCACACTCCTTTAGG + Intergenic
960003404 3:112756326-112756348 CCTCCCACCAGGACCCCTTGCGG - Intronic
961209533 3:125115040-125115062 ACTCCCTTCCACACTCCTTATGG - Intronic
961794901 3:129402479-129402501 CCTCCCACCTTCCTTCCTTGTGG + Intronic
962140412 3:132784407-132784429 CCTCCCTCCCTCCCTCCTTTTGG + Intergenic
962527094 3:136246638-136246660 CCATCCATCCTCACTCCTTGTGG + Intergenic
962923235 3:139969718-139969740 CCTCCCACCACCACTCTTGGAGG + Intronic
963907063 3:150781540-150781562 CCTCCAACCCATTCTCCATGTGG - Intergenic
964493288 3:157260194-157260216 TGTCCCACCCACACTCAATGGGG + Exonic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967977892 3:195045634-195045656 CCCTCCACCCTCACTCCATGCGG + Intergenic
968126761 3:196165793-196165815 CCTCCCACCTTCACTCCTCTGGG - Intergenic
968183670 3:196616031-196616053 CCTCCCACCCTCCCCCCTTCTGG + Intergenic
968235610 3:197028890-197028912 CCTCCCCTCCCCACTCCTGGCGG + Intronic
968483433 4:847436-847458 GCTCCCACCCAGACTGCGTGAGG + Intergenic
968684377 4:1947164-1947186 CCTCCCCAGCACACTCCCTGTGG + Intronic
968937416 4:3618909-3618931 GGTCCCTCCCACACTACTTGGGG + Intergenic
969038791 4:4277457-4277479 CCTCCCTCCCTCTCTCCCTGTGG - Intronic
969572052 4:8014861-8014883 CCTCCCTCCCTCTCTCCTTCCGG + Intronic
971662659 4:29439965-29439987 CCTCCCTCCCACACGCCTCCAGG - Intergenic
971841774 4:31861975-31861997 GCTCCCAGCCACACTCCTATTGG - Intergenic
973908843 4:55558273-55558295 CCTCCCACCCACAACACGTGGGG - Intronic
974521527 4:62987147-62987169 CCTGCCACTCCCACCCCTTGGGG - Intergenic
976275829 4:83277033-83277055 CCTCCCACCCTCCCACCTTTTGG - Intronic
976902697 4:90198205-90198227 CCACCCACCCACACAACTTCAGG - Intronic
977949051 4:102948810-102948832 CCTCCAACCCTCTCTCCTTTTGG - Intronic
978368382 4:108006173-108006195 CCTCCCCCACACACTCCCTAAGG - Intronic
978686624 4:111452852-111452874 CCTCCCACCCTCCCACCTTTTGG - Intergenic
980933936 4:139208229-139208251 CCACCCACCCACCCTCAATGTGG - Intergenic
981061717 4:140432018-140432040 CCCCCCACACAGAGTCCTTGTGG + Intergenic
981944478 4:150325213-150325235 CCTCACTCACACACTGCTTGGGG - Intronic
982266276 4:153541364-153541386 CCTCACCCCCACATTCCATGAGG - Intronic
984463072 4:180059464-180059486 CCTCCCCCCCACCCTCCTCTCGG - Intergenic
987868141 5:23573443-23573465 CCTCCCACCCTCCCACCTTTTGG + Intergenic
988109161 5:26793227-26793249 CCTCCCGCCCCCACTCCTCACGG - Intergenic
988774532 5:34465824-34465846 CCTTCCATCCACTCTCCTAGGGG - Intergenic
988879236 5:35482445-35482467 CCTCCCAGCCTCACTGCTTGTGG + Intergenic
989554996 5:42783739-42783761 CCTCCCACCCTCCCTTCTTTTGG + Intronic
995133064 5:108650500-108650522 ACCCCCAGCCACACTCCTTTTGG - Intergenic
998128680 5:139640291-139640313 CCTCCCTCCCACCTTCCTGGAGG - Intergenic
998583310 5:143403081-143403103 CCCCCCACCCCCACTCCCCGAGG + Intronic
999895926 5:156033384-156033406 CCTCCCACCCTCTCTCCTTTTGG + Intronic
1001024390 5:168211281-168211303 CCTCCCTCCCACACTCAGAGGGG + Intronic
1001048567 5:168395306-168395328 GCTCCGCCCCACACCCCTTGAGG + Intronic
1001307391 5:170585463-170585485 CCTCTCAGCCCCACTCCTCGTGG + Intronic
1001427431 5:171632725-171632747 CCTCCCTCCCACAGCCCTTTAGG + Intergenic
1001971404 5:175957585-175957607 CCTCCCACCCACACAGGTTAAGG + Intronic
1002246038 5:177886192-177886214 CCTCCCACCCACACAGGTTAAGG - Intergenic
1002639047 5:180621991-180622013 CCTCCCTCCCTCTCTCCTGGAGG + Intronic
1002772396 6:301137-301159 CTTCCCACCAAGACTCCCTGGGG + Intronic
1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG + Intronic
1004535261 6:16494181-16494203 CCTCCCTCCAACTCTTCTTGAGG - Intronic
1004704722 6:18113868-18113890 CTTCCCACCAACACTGCATGAGG - Intergenic
1004868331 6:19876461-19876483 CCTCAAACCCATACTACTTGGGG + Intergenic
1006024795 6:31139891-31139913 CCTCCCTCCCATTCTCCTTTTGG + Exonic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1007823548 6:44580077-44580099 GCTCCCACCCACCTTCTTTGGGG - Intergenic
1011310913 6:85978508-85978530 CCCCCCACCCCAACTCCCTGGGG + Intergenic
1011597516 6:89030127-89030149 CCTCCCCTCCCCAGTCCTTGGGG + Intergenic
1012967944 6:105695783-105695805 CACCCCACCCACCCTACTTGTGG + Intergenic
1014391512 6:120871720-120871742 CCTCCTTCCCACTCTACTTGGGG - Intergenic
1016665396 6:146633508-146633530 CCTCCCACTCACACAGCTTAAGG + Intronic
1017062007 6:150492847-150492869 CCTTCCATCCTCCCTCCTTGTGG + Intergenic
1017456611 6:154606615-154606637 CCTCCCACGCAGACTCGTGGGGG + Intergenic
1017987952 6:159460865-159460887 CCTCCCACCCACTCCCCTTAGGG + Intergenic
1019437092 7:1028005-1028027 CCTCCCACTTACTCTCCTGGGGG - Intronic
1020901372 7:14007953-14007975 CCTCCCACCCTCTCACCTTTTGG + Intergenic
1022503714 7:30897766-30897788 CCTCCCACCCACTTTCCTTCAGG - Intergenic
1023172608 7:37404282-37404304 CCTTCCACCTTCACTCCGTGTGG + Intronic
1024055570 7:45658030-45658052 CCTGCCAACCAGACTCCCTGTGG + Intronic
1024085067 7:45885689-45885711 CGTCCCACCCATCCTCCCTGAGG - Intergenic
1024301786 7:47892546-47892568 CCTCCCAACCTCCCTCCTTTTGG - Intronic
1025941049 7:66076317-66076339 CCACCAACCCACACTACTAGGGG + Intronic
1026803069 7:73411933-73411955 TCTCCCACCCACACTCGGGGAGG + Intergenic
1027221091 7:76214352-76214374 CCTCCCACCCACCATCCCTCAGG + Intronic
1027578090 7:79956326-79956348 CTTCCCACCCTCCCTCCTTTTGG - Intergenic
1028170672 7:87591693-87591715 ACCCCCACCCCCATTCCTTGAGG - Intronic
1029968760 7:104768453-104768475 CCTGTCACCCACACACCTAGGGG + Intronic
1030587213 7:111435520-111435542 CCTCCCACCCTCCCACCTTTTGG - Intronic
1031341152 7:120603651-120603673 CCTCCTCCCCTGACTCCTTGGGG + Intronic
1032317089 7:130848127-130848149 CCTCCCTCCCTCCCTCCTTTTGG + Intergenic
1032395965 7:131590262-131590284 CCTCCCACCCTCCCACCTTTTGG - Intergenic
1033244534 7:139707062-139707084 CTTCCCAGGCACACTCCTGGAGG + Intronic
1033412248 7:141128677-141128699 CCTCCCTACCACACTCATCGTGG - Intronic
1033508138 7:142026595-142026617 CCTCCCACCTACTCTCCTAAGGG - Intronic
1033798315 7:144873374-144873396 TCTCCCACTTCCACTCCTTGAGG + Intergenic
1034901504 7:154910527-154910549 CCCCACACCCACATTCCTTTTGG + Intergenic
1034972451 7:155427688-155427710 CCCCCCAGCCACACTCCCTACGG + Intergenic
1035294084 7:157858050-157858072 GCTACCACCCACACTCCTGCAGG + Intronic
1035294217 7:157858523-157858545 GCTACCACCCACACTCCTGCAGG + Intronic
1035294247 7:157858625-157858647 GCTACCACCCACACTCCTGCAGG + Intronic
1035294258 7:157858660-157858682 GCTACCACCCACACTCCTGCAGG + Intronic
1035294269 7:157858695-157858717 GCTACCACCCACACTCCTGCAGG + Intronic
1035294299 7:157858797-157858819 GCTACCACCCACACTCCTGCAGG + Intronic
1035294319 7:157858864-157858886 GCTACCACCCACACTCCTGCAGG + Intronic
1035294330 7:157858899-157858921 GCTACCACCCACACTCCTGCAGG + Intronic
1035294463 7:157859372-157859394 GCTACCACCCACACTCCTGCAGG + Intronic
1035294493 7:157859474-157859496 GCTACCACCCACACTCCTGCAGG + Intronic
1035294504 7:157859509-157859531 GCTACCACCCACACTCCTGCAGG + Intronic
1035385371 7:158468771-158468793 CCACCCACACACACTCCCGGTGG + Intronic
1035385414 7:158469053-158469075 ACACCCACACACACTCCTGGTGG + Intronic
1035466714 7:159084258-159084280 CCTCCCGCCCACACCTCGTGCGG - Intronic
1035474422 7:159132062-159132084 CCTCCCCCTCACATTCCTTCAGG + Intronic
1035478833 7:159164826-159164848 CCTCCCCCTCACATTCCTTCAGG - Intergenic
1035543433 8:459688-459710 CCTCTCAGACACACTCCGTGAGG - Intronic
1035746301 8:1963934-1963956 CCTCGCACCCACAATCCAAGGGG - Intergenic
1036123054 8:6038610-6038632 CCCTCCTCCCACACTCCCTGGGG - Intergenic
1036752785 8:11453937-11453959 CCTACTGCCCACACTCCTTGGGG + Intronic
1037706676 8:21321371-21321393 CCTCCCACCCCTACTTCTTGAGG + Intergenic
1038256754 8:25957485-25957507 CCTCCCATCCCCACTGCCTGTGG + Intronic
1039737833 8:40351304-40351326 CCTCCCTCCCTCACTGCTTTTGG + Intergenic
1039837375 8:41267539-41267561 GCTTCCACCCACACACCCTGAGG + Intronic
1040575508 8:48647950-48647972 CCTCCCACCCACACCCGTGCAGG - Intergenic
1041318908 8:56593705-56593727 CCTCCAGCCCACACTCCATGTGG - Intergenic
1042365959 8:67936638-67936660 CCTCCCAGCCCCACTCTGTGAGG - Intergenic
1042523494 8:69740241-69740263 TCTCCCACCCCAACTCCTGGAGG - Intronic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1046490280 8:114943275-114943297 CCTCCCACCCCCACGCCTCAAGG - Intergenic
1046744273 8:117860346-117860368 CCTTCCACCCTCCCACCTTGAGG - Intronic
1047493265 8:125391055-125391077 CCTCCCACCCTCACTCCTCCAGG - Intergenic
1049306408 8:141906558-141906580 CCTCCACTCCACTCTCCTTGGGG - Intergenic
1049410206 8:142470639-142470661 CCTCCCATACCCACTCCCTGTGG - Intronic
1049559879 8:143304670-143304692 CCACCCACCCAGACGCCTGGTGG + Intronic
1049633452 8:143672431-143672453 CCTCCCTCCAACCCTCCTTCAGG + Intergenic
1053512691 9:38702256-38702278 CATTCCAGCCACACTCCTGGTGG - Intergenic
1055468928 9:76592404-76592426 CCTGCCCCCCACCCTCTTTGTGG + Intergenic
1055969444 9:81897160-81897182 CATCCCTTCCACCCTCCTTGTGG - Intergenic
1056291443 9:85147879-85147901 CCACCCACCCACACACAGTGAGG + Intergenic
1057273462 9:93663969-93663991 CCTCACACCCACACTACAGGTGG - Intronic
1057304474 9:93904295-93904317 CCTGCCAGGCACACTCCTGGCGG - Intergenic
1057938110 9:99257684-99257706 CTTCTCACCCACACTCCTCATGG - Intergenic
1058537306 9:105975368-105975390 CCCCCCACCCATTGTCCTTGAGG - Intergenic
1060011631 9:120048623-120048645 CCTGCTACCCACAATCCTTCAGG + Intergenic
1060301096 9:122375100-122375122 CCGCCCACCCTGACACCTTGGGG + Intronic
1060953137 9:127617764-127617786 CCTCCTACCCACTCTTCTAGTGG - Intronic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1060967771 9:127721235-127721257 CCGCTGACCCACACTCCCTGCGG - Intronic
1061611816 9:131751776-131751798 CCTCCCACTCACACCCCCTGTGG + Intergenic
1061806186 9:133138971-133138993 ACTCCCTCCCACACTCACTGTGG + Intronic
1062088438 9:134661112-134661134 TCTCCCACCCAGCCTCTTTGGGG - Intronic
1062323676 9:136002773-136002795 CCTACCACACACACACATTGAGG - Intergenic
1062560021 9:137137373-137137395 CCACCCACCCCCACCCCGTGGGG - Intergenic
1185451227 X:281365-281387 CCTCCCTCCCTCCCTCCTTCCGG + Exonic
1186162801 X:6795453-6795475 CCTCCCACCCACCATCATGGGGG + Intergenic
1186812212 X:13201579-13201601 CCTCCCATCCTCACTCCACGGGG + Intergenic
1188818909 X:34749093-34749115 CCTCCCACCCCCACTATCTGTGG - Intergenic
1190500872 X:51077240-51077262 TCTTCCACCCTCACTCCTTGAGG + Intergenic
1190843987 X:54174063-54174085 CCTCCAACCAACACTCAGTGAGG - Intronic
1190862957 X:54360841-54360863 CCTCCTACCCCCACTCCTGTGGG - Intergenic
1192428495 X:71097073-71097095 CCTCCCACCCCCACCCCCTTTGG + Intronic
1193400990 X:81042239-81042261 CCTCCCACTCTCACACCTTTTGG + Intergenic
1195347276 X:103962954-103962976 CCTCCCACCCCGACTCCCCGGGG - Exonic
1195360166 X:104075887-104075909 CCTCCCACCCCGACTCCCCGGGG + Intergenic
1195877458 X:109557085-109557107 TCTCTCACCCCTACTCCTTGTGG + Intergenic
1198573788 X:137987601-137987623 CCTCTCACCCTCACCCCATGGGG - Intergenic
1199153007 X:144511442-144511464 CCTCCCACCCTCTCCCCTTTTGG - Intergenic
1199637473 X:149826922-149826944 CCCTCCCCCCACCCTCCTTGTGG - Intergenic
1199771440 X:150977762-150977784 CCTCCAACCCAGCCTCCTCGTGG - Intergenic
1200100295 X:153686781-153686803 CCAACCACACACACCCCTTGAGG + Intronic
1201184382 Y:11385064-11385086 CCTCCAACCCTCTCTCCTTTTGG - Intergenic