ID: 1006087615

View in Genome Browser
Species Human (GRCh38)
Location 6:31607750-31607772
Sequence GGGTATATAGGAAGACAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006087615_1006087622 2 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087622 6:31607775-31607797 CAGTATTCACTTTTTTTGGTGGG No data
1006087615_1006087623 3 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087623 6:31607776-31607798 AGTATTCACTTTTTTTGGTGGGG No data
1006087615_1006087628 30 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087628 6:31607803-31607825 TGGAGTTTCGCTTATTGCCCAGG No data
1006087615_1006087621 1 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087621 6:31607774-31607796 TCAGTATTCACTTTTTTTGGTGG No data
1006087615_1006087627 10 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087627 6:31607783-31607805 ACTTTTTTTGGTGGGGGGGATGG No data
1006087615_1006087624 4 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087624 6:31607777-31607799 GTATTCACTTTTTTTGGTGGGGG No data
1006087615_1006087626 6 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087626 6:31607779-31607801 ATTCACTTTTTTTGGTGGGGGGG No data
1006087615_1006087625 5 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087625 6:31607778-31607800 TATTCACTTTTTTTGGTGGGGGG No data
1006087615_1006087620 -2 Left 1006087615 6:31607750-31607772 CCCGCTTGTCTTCCTATATACCC No data
Right 1006087620 6:31607771-31607793 CCTTCAGTATTCACTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006087615 Original CRISPR GGGTATATAGGAAGACAAGC GGG (reversed) Intergenic
No off target data available for this crispr