ID: 1006089486

View in Genome Browser
Species Human (GRCh38)
Location 6:31620209-31620231
Sequence CGGGCGGGATTAGCTGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006089486_1006089500 25 Left 1006089486 6:31620209-31620231 CCTCCGGCAGCTAATCCCGCCCG No data
Right 1006089500 6:31620257-31620279 TCCCTAGCTGAAGGCGCCACGGG No data
1006089486_1006089499 24 Left 1006089486 6:31620209-31620231 CCTCCGGCAGCTAATCCCGCCCG No data
Right 1006089499 6:31620256-31620278 CTCCCTAGCTGAAGGCGCCACGG No data
1006089486_1006089498 16 Left 1006089486 6:31620209-31620231 CCTCCGGCAGCTAATCCCGCCCG No data
Right 1006089498 6:31620248-31620270 CTCTCTTTCTCCCTAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006089486 Original CRISPR CGGGCGGGATTAGCTGCCGG AGG (reversed) Intergenic
No off target data available for this crispr