ID: 1006089954

View in Genome Browser
Species Human (GRCh38)
Location 6:31622514-31622536
Sequence CTGGGGGAAAGGAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 864
Summary {0: 1, 1: 0, 2: 6, 3: 90, 4: 767}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006089950_1006089954 -8 Left 1006089950 6:31622499-31622521 CCTTGACAAAGGTGTCTGGGGGA 0: 1
1: 2
2: 13
3: 46
4: 228
Right 1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG 0: 1
1: 0
2: 6
3: 90
4: 767

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006089954 Original CRISPR CTGGGGGAAAGGAGGGAACA TGG Intronic
900088169 1:908550-908572 GCGGGGGAGAGGAGGGAAAAGGG + Intergenic
900092667 1:927234-927256 CTGCTTGAAAGGAGGGAACTGGG - Intronic
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900687113 1:3955630-3955652 CTGTGGGAAAGGAGCCAATAAGG - Intergenic
901618285 1:10559814-10559836 TTGTGGTAAAGGATGGAACAGGG + Intronic
901690019 1:10966756-10966778 CTGGGGCAAAGGAGGAAGCCGGG - Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
902286835 1:15412598-15412620 CTGGGGGAAAGGAGAGACGGGGG - Intronic
902376270 1:16031471-16031493 CTGGGGGACATGGGGGACCAGGG + Intronic
902519854 1:17010088-17010110 CAGGGGGGAAGGGGGGAACGGGG - Intronic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902879729 1:19363541-19363563 CTGGGGGGAAGGAGAAAAAAGGG + Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
904433171 1:30478298-30478320 GTGGTGGGAAGGAGGGAGCACGG + Intergenic
904452273 1:30621460-30621482 CTGGGGGAGTCAAGGGAACAAGG - Intergenic
904842103 1:33379367-33379389 CCGGGGGGAAGGGGGGGACAGGG - Intronic
904868837 1:33603605-33603627 CTGGGAGACAGTGGGGAACAAGG + Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905208695 1:36358351-36358373 CTGGAGGAGAGGGGGGACCAAGG - Exonic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905452902 1:38068453-38068475 CTGGTGGGAGGGAGGGAGCAAGG + Intergenic
905528882 1:38660902-38660924 CTGGGTGAAAGGAGAAAACCAGG - Intergenic
905765522 1:40596902-40596924 TTGGGGGAAAAAAGGGAGCAAGG - Intergenic
905776186 1:40668824-40668846 CTGGCGGGCAGGAGGGGACAGGG - Intergenic
905860981 1:41351249-41351271 ATGGGAGATGGGAGGGAACAGGG - Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
905969010 1:42126709-42126731 CAGGGTGAAGGGAGGAAACAGGG - Intergenic
906150473 1:43584533-43584555 GTGGGGGAAGGGAGGGGACGAGG - Intronic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
907512802 1:54974604-54974626 CTGGGGGAAATGAGGAATTAGGG + Intergenic
907553002 1:55319891-55319913 AGGGTGGAAAGGAGGGAGCAGGG + Intergenic
908179931 1:61593610-61593632 AGGGGGGAAAAGAGGGAACTGGG - Intergenic
908463321 1:64367225-64367247 CTGGGGGAAAGGAGGCAATGGGG + Intergenic
908954780 1:69610249-69610271 CAGGAGAAAAGGAGGGAAAAAGG - Intronic
909219076 1:72931323-72931345 AAGGGAGAAAGGATGGAACAAGG - Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
911536921 1:99111029-99111051 CTGGGGGAAAGAAGAGATTATGG - Intergenic
912031251 1:105247288-105247310 GTGGGGGAAAGTGGGGAACCGGG + Intergenic
913091430 1:115479117-115479139 CGGGGGGAAAGGGGGGAAAGGGG + Intergenic
913327802 1:117642603-117642625 CTGGGAGAAAAGAGAGTACAAGG - Intergenic
913471346 1:119190450-119190472 GTGGGGGAAGGGAGGGAGTAGGG - Intergenic
914425877 1:147575386-147575408 CTGGGCAAAAGCAGTGAACAAGG - Intronic
915017307 1:152746015-152746037 GTGGGGGGCAGGAGGGATCATGG - Intronic
915479942 1:156177623-156177645 CTAGGGTAAAGGAGTGAAGAAGG - Exonic
915518706 1:156429050-156429072 CTGGGGGAAGGAGGGGAACCAGG + Intronic
915552091 1:156641263-156641285 CTGGGGGAAAGGAGGGTCATTGG + Intergenic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915977491 1:160400641-160400663 CTGGGGGCCAGGGGGGAATAGGG - Exonic
915981619 1:160424029-160424051 CTAGGGGACAGGAGGGGACTGGG - Intronic
916070441 1:161166817-161166839 CTGGGGGAAAGGGGGCGATATGG - Intronic
916576451 1:166071187-166071209 CTGGTGGAAAGAAGGGCAAAAGG + Intronic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917058035 1:171004768-171004790 CTGGTGACAAGGAGGGATCATGG - Intronic
917511645 1:175674046-175674068 CTGGTGGCAAAGAGGAAACAAGG + Intronic
917645963 1:177029095-177029117 CCAGGGGAAAGGAAGGAACTGGG + Intronic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
921935998 1:220797656-220797678 ATGGTGGAATGAAGGGAACAAGG - Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922518864 1:226228649-226228671 CTGGGGGAATGGCAGGGACAAGG - Intergenic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923326995 1:232888774-232888796 CTGCAGGTAAGGAGTGAACAAGG + Intergenic
923336709 1:232977238-232977260 CTGGGGGGCAGGCAGGAACAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923509389 1:234636726-234636748 CTGGACGAAAGGAGGCAATAGGG + Intergenic
923724590 1:236495276-236495298 ATGGGGAGAAGGAGGGAACTGGG + Intergenic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
923861781 1:237898918-237898940 CAGGGGGAAGGAAGGGATCAGGG - Intergenic
924317961 1:242817910-242817932 CTGGGGGCAAGAATGGGACATGG + Intergenic
924395566 1:243616200-243616222 TTGGGGGAAAGGATGGAAGCAGG - Intronic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
1062763457 10:44925-44947 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1062822871 10:548124-548146 CTGGGGCAGAGGTGGGGACAGGG - Intronic
1063909462 10:10814652-10814674 CTGGGCCAAATGAGGTAACATGG + Intergenic
1063955884 10:11266575-11266597 CTGTGGGAAACAAGGGGACAGGG - Intronic
1063961315 10:11307652-11307674 GTTGGGGAGATGAGGGAACAAGG + Intronic
1064070485 10:12224966-12224988 CTTGGGGAAAGGAAGAAATAGGG - Intronic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065115173 10:22477301-22477323 CTGGTGGAGGGGAGGGAACTGGG - Intergenic
1065200763 10:23310802-23310824 TTTGGGGAAAGCAGGCAACATGG - Intronic
1066253000 10:33652371-33652393 CCTGGGGAGAGGAGGGAATAGGG - Intergenic
1066300431 10:34091186-34091208 GTGGAGGAGACGAGGGAACAAGG + Intergenic
1066584896 10:36922000-36922022 CAGGGAGAAAGAAGGGAAGATGG - Intergenic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067720305 10:48723126-48723148 AGGGTGGAAAGGAGGGAAAAGGG - Intronic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1068574992 10:58675169-58675191 CTGGGAGAGAGGAGAGAACAAGG + Intronic
1068742401 10:60488559-60488581 CTGGGAGAAAGGGGAGAACAGGG - Intronic
1069328994 10:67267779-67267801 CTGGGAGACAGGCTGGAACATGG + Intronic
1069597982 10:69684973-69684995 CTGGGGGAATGCTGGAAACAAGG + Exonic
1069802985 10:71093754-71093776 CATGGGGCAAGGAGGGAGCAGGG + Intergenic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1070313340 10:75289237-75289259 CTGGGGGAGAGGAAGGGCCAGGG + Intergenic
1070539910 10:77408661-77408683 CTTGGGAAAAGAAAGGAACATGG + Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071306401 10:84302826-84302848 CTGGGGGAGAGGAGGCAGCATGG - Intergenic
1071449061 10:85777268-85777290 CTGGGAGAAAGGAGGGCCCAGGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1072273767 10:93802404-93802426 AGGGAGGAAAAGAGGGAACAAGG + Intergenic
1073034002 10:100550473-100550495 TTGGTGGAAAGGAAGGAGCAAGG - Exonic
1073185573 10:101613378-101613400 CTGGGGGAAATGAAGGAAAAGGG + Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073440352 10:103549053-103549075 CAGGCAGAAAGGATGGAACAAGG - Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1073604503 10:104880343-104880365 CTGGGGGAAAGGATTGTTCAAGG - Intronic
1073852385 10:107635818-107635840 ACGGGGGGAAGGAGGGAGCAAGG + Intergenic
1073995256 10:109308352-109308374 CCAGGAGAAAGGATGGAACAGGG - Intergenic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074868017 10:117556082-117556104 CTGGGAGAAAGCAGGGAAGCGGG - Intergenic
1075778596 10:125003213-125003235 CAGCAGGAAAGCAGGGAACAGGG + Intronic
1075872336 10:125779888-125779910 GTGGGGGAAAGGTGGGACCTGGG + Intergenic
1076062582 10:127425185-127425207 CTGGGGGGAAGCAGAGACCAGGG + Intronic
1076527301 10:131120098-131120120 CTGGGGGAAGGGACAGAACCGGG - Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077290245 11:1786160-1786182 GTGGGGAAGAGGGGGGAACAGGG - Intergenic
1077339391 11:2019234-2019256 CTGGGGGAGACGCGAGAACAGGG + Intergenic
1077431252 11:2517040-2517062 CTCCTGGAAAGGAGGGATCAGGG + Intronic
1077485420 11:2836261-2836283 CTTGGGGAAAGCAGGGAGAAGGG + Intronic
1079025221 11:16941944-16941966 CTGGGGTACAGCAGTGAACAAGG - Intronic
1079729428 11:23921418-23921440 GTGGGGGAAAGGTGGCATCAGGG + Intergenic
1079923482 11:26461139-26461161 CCGGGGGAAAGGAAGGAAAGGGG + Intronic
1080202887 11:29693972-29693994 TTGGGGGAAAGGATGGAAGGGGG - Intergenic
1080303340 11:30809803-30809825 CTGGGGGAAAGAAACAAACAAGG - Intergenic
1080539943 11:33256491-33256513 CTAGGGAAAAGGAGGAAAGATGG + Intergenic
1081006072 11:37741955-37741977 CTGGGGGAGGGGAGGGAACCTGG + Intergenic
1081232140 11:40598724-40598746 CTGAGGAAAAGATGGGAACAGGG + Intronic
1081413321 11:42785238-42785260 CTGGGGGCAAAGAGTGACCAGGG + Intergenic
1081577509 11:44328363-44328385 CTGGGGGAGAGGAGGGGAAGGGG - Intergenic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082835982 11:57650202-57650224 CTGGAGGAAAGGAGGTGGCAAGG + Intronic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083318064 11:61828390-61828412 CATGGGGAAGGGAGGGAACCAGG + Exonic
1083413822 11:62512471-62512493 CAGGGGCAAAGGAGGCCACAAGG - Intronic
1083464168 11:62834234-62834256 TTGGGGGAAAGGAAGGAGCAGGG - Intronic
1083555491 11:63622939-63622961 CTGGGGAGAAGGAAGGACCAGGG - Intergenic
1084343478 11:68526084-68526106 CTGGAGGAGAGTAGGAAACATGG - Intronic
1085314391 11:75535569-75535591 CTGGGGGAAAGAAGAGAACCCGG - Intergenic
1085394921 11:76202423-76202445 CACGGGGAAAGGAGGGACAAAGG - Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085692718 11:78676971-78676993 CTGAGGGGCAGGAGGGAACGTGG + Intronic
1087218235 11:95517907-95517929 ATGGGGGACAGAAGGGAACTGGG + Intergenic
1087628829 11:100626695-100626717 GAGTGTGAAAGGAGGGAACAAGG + Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088824697 11:113483820-113483842 CTGAGGGAAGGCTGGGAACATGG - Intergenic
1089204557 11:116749092-116749114 GTGGGGGAAGGGTGTGAACAAGG - Intronic
1089215296 11:116831095-116831117 CGGGGAGAAAGGAGGGACCTGGG - Intronic
1089397995 11:118148362-118148384 CTGGGGGAGAGGGGGGAACCAGG + Intronic
1089517751 11:119044612-119044634 CCTGGGGAAAGGAGAGACCATGG - Exonic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1089833682 11:121351119-121351141 CTAGGAGAAAGTAGGTAACAGGG - Intergenic
1090374908 11:126281831-126281853 CTGGGGAAAAGGAGGGCCCTGGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090648540 11:128786597-128786619 CTGGAGGACGGGAGAGAACAAGG - Intronic
1090744581 11:129695943-129695965 CTGGGGGAAAGAAGCGAAGTGGG + Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1090977840 11:131691487-131691509 CGGGGGGCCAGGAGGGAGCAAGG - Intronic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1202822376 11_KI270721v1_random:74423-74445 CTGGGGGAGACGCGAGAACAGGG + Intergenic
1091395585 12:152439-152461 GTGAGGGAGAGGAGGGCACAGGG + Intronic
1091750709 12:3019799-3019821 CTGGGGGACAGAAGGCAGCAGGG - Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095870962 12:47027402-47027424 CCTGGGTAAAGGACGGAACAAGG + Intergenic
1096214413 12:49791606-49791628 CTGGGTGAGAGAAGGGACCAAGG + Exonic
1096262817 12:50103671-50103693 CTGGGGGACAGAAAGGAGCAAGG + Intergenic
1096864846 12:54556449-54556471 CTGGGGGATACTAGGGCACAGGG - Intronic
1097070536 12:56351247-56351269 CTGGGGGAAAGAAGGAACAAGGG - Intronic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1097541018 12:60943324-60943346 TTGGTGGAAAGGAATGAACAAGG + Intergenic
1097608433 12:61785098-61785120 CAGGAGGGAAGGAGGGAATAGGG - Intronic
1098740941 12:74172272-74172294 TTGGTGGAAAGCAGGGAAAATGG + Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1101091867 12:101295180-101295202 CTGGGGGTAGGGAGGGTTCATGG + Intronic
1101519826 12:105471242-105471264 CTGGGGCCAAGCGGGGAACAAGG + Intergenic
1101850651 12:108399444-108399466 CTGGGGAAAAGTTGAGAACAAGG + Intergenic
1102543428 12:113638296-113638318 CTGGGGGGAGGGAAGCAACAGGG + Intergenic
1102574864 12:113849934-113849956 CTGGAGGAAAGAGGGGAAGAGGG + Intronic
1102590979 12:113956633-113956655 CACAGAGAAAGGAGGGAACAGGG + Intronic
1102717425 12:114986386-114986408 AGGGAGGAAAGGAGGGAAAAAGG - Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102771500 12:115481233-115481255 CTGGGGGCTGGGAGGGCACATGG - Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103448694 12:121012476-121012498 TTGGGGCAAAGGCAGGAACACGG + Intronic
1103468707 12:121162775-121162797 CTGGGGGAAGGAAGGGGCCAGGG - Intronic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103889385 12:124227378-124227400 CTGGGGGAAGGGAAGGAATGAGG + Intronic
1103910144 12:124347789-124347811 TTGGGGGCAACGAGGGAGCAGGG + Intronic
1104386495 12:128355679-128355701 GTGGAGGAAAGGAGGGAATAAGG - Intronic
1104604292 12:130176651-130176673 TTGGGGGAAAAGAGAGACCAAGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105330728 13:19412817-19412839 ATGGGGGAAGGGAGGGGGCACGG - Intergenic
1105681234 13:22729283-22729305 CTGGGGGAAAGGGTGGGAGAGGG + Intergenic
1105759760 13:23503216-23503238 CTGGGGCAAGGGCAGGAACATGG - Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1107591602 13:41913281-41913303 CTGGGGGTAAGGAGTGGCCATGG + Intronic
1108498397 13:51046422-51046444 GTGAGGGAAAGGAGGGAATGAGG + Intergenic
1110121700 13:71889732-71889754 CTGGGGGACAGGAAGGTTCAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111198566 13:84905149-84905171 CTGGGGGAGAGAAGGCAGCATGG - Intergenic
1111766711 13:92539704-92539726 CTGGGGCAAAGGAGGCTATAAGG - Intronic
1112324521 13:98434469-98434491 CTGGGGGAAAGCAGTGAAAGAGG + Intronic
1112472935 13:99705745-99705767 CTGGGGGGAAGGAGGGAATGGGG + Intronic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1113847014 13:113397994-113398016 CGGGGGGAAGGGAGGGAGAAGGG + Intergenic
1113926862 13:113946608-113946630 CAGGGTGAAAGGAGGGCACTGGG + Intergenic
1113992015 14:16035396-16035418 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1114583163 14:23784186-23784208 CTGGGGGAAAAGGGGGAATCTGG + Intergenic
1114646404 14:24258885-24258907 CTAAGGGAAAGGAGGGAGAAGGG - Intronic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1115884838 14:37959466-37959488 CTGGGGGCAAGCAGAGATCATGG + Intronic
1115902989 14:38174868-38174890 ATCGGGGAAAGGAGGGACAAAGG - Intergenic
1116222742 14:42110443-42110465 CTAGGGGATAGGAGGCAAGATGG + Intergenic
1116749385 14:48863900-48863922 CAGAGGGAAAGAAGGGGACAAGG + Intergenic
1117485717 14:56194792-56194814 CTGGTGGAAAGGAGGCTAGAAGG - Intronic
1117677356 14:58168282-58168304 CTGGGGGAATGGAATGAACTAGG + Intronic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1118589716 14:67392428-67392450 CTAGGGGGAAGGAGGGAGCAAGG + Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1120635394 14:86944116-86944138 CTGGTGGAAGGAAGGGAAAAAGG - Intergenic
1121310560 14:92933158-92933180 CTGGGGGCCAGGAGGGGACACGG - Intronic
1121567636 14:94922795-94922817 CTGGGAGAAAGGCGGCCACAGGG - Intergenic
1121576165 14:94989871-94989893 CTGGGGCAAAGGAGGGTCCGTGG - Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1122679933 14:103451895-103451917 CTGCGGGAGAGGAGAGGACACGG - Intronic
1123414256 15:20083502-20083524 CTGGCGGAAGGCTGGGAACACGG - Intergenic
1123523598 15:21090613-21090635 CTGGCGGAAGGCTGGGAACACGG - Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1124156719 15:27232656-27232678 CTTGGGGATAGGAGACAACAAGG + Intronic
1124369775 15:29097805-29097827 CTGGGGCAAAGGAGTGAAGGGGG - Intronic
1125481855 15:40086655-40086677 CAGAGAGAAAGGAGGGAACAAGG + Intergenic
1125941404 15:43681009-43681031 GAGGGAGAAAGGAAGGAACAGGG - Intergenic
1126636622 15:50786295-50786317 CTGGGGAATAGGAAGCAACATGG - Intergenic
1126695276 15:51320669-51320691 TTTGGGGACAGGAAGGAACAGGG - Intronic
1126810469 15:52398000-52398022 CTGGGTGAAAGGAGGAGAAAAGG + Intronic
1126979887 15:54228751-54228773 CTTGAGGAAAGGAGGGGAGAGGG - Intronic
1127089843 15:55456463-55456485 TTGGGAGATAGGAGGGAAAATGG + Intronic
1127359441 15:58232027-58232049 ATGATGGAAAGGAGGGAACAAGG + Intronic
1127485346 15:59413174-59413196 CTGTGGGAGATGGGGGAACATGG + Intronic
1128220394 15:65964608-65964630 ATGGGAGCAAGGAGAGAACAAGG - Intronic
1128550283 15:68593947-68593969 TTGGGGGAAAGGGAGGAACTAGG + Intronic
1128578420 15:68791745-68791767 CAGAGGGGAAGGAGGGGACAGGG + Intronic
1128583890 15:68830398-68830420 GTGGGGGAAAGCAGGCCACAGGG - Intronic
1128654667 15:69451980-69452002 CTTGGGGGAAGGAGGGATTATGG - Intergenic
1128669442 15:69563448-69563470 TAAGGGGAGAGGAGGGAACAGGG + Intergenic
1129121186 15:73397704-73397726 CAGGGGAAAAATAGGGAACAAGG + Intergenic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130371184 15:83285839-83285861 AGAAGGGAAAGGAGGGAACAAGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131315110 15:91328997-91329019 CTAGAGGAAAGGAGTGAAAAGGG - Intergenic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1132435451 15:101797656-101797678 TTGGGGGAAAGGATGGGAGAGGG + Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133042546 16:3068158-3068180 CCTGGGGAGAGGAGGGCACAGGG - Exonic
1133482475 16:6184346-6184368 GTGTGGGAAAGGATGGAACCAGG + Intronic
1133497884 16:6337196-6337218 TTGGGGGAAATGAGAGAAAAGGG - Intronic
1134068340 16:11244727-11244749 ATGGAGGAAAGGAGGAACCAGGG - Intergenic
1134075774 16:11290401-11290423 GTGGGGACAAGGGGGGAACAAGG + Intronic
1134311172 16:13076471-13076493 GTGGGGGAAAGGAGGGAGCAGGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1135221790 16:20620831-20620853 CTGGGGGAAGGAAGGGGATAGGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135887707 16:26326504-26326526 AAGGAGGAAAGGAGGGAAGAAGG + Intergenic
1136073530 16:27803139-27803161 CCGGGGGAGAGGAGGGACCTAGG - Intronic
1136187544 16:28597017-28597039 CTGCGGGCGAGGAGGGCACAAGG - Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1136624500 16:31453734-31453756 CTGGGGGAGAAGAAGGAAAACGG + Intergenic
1137646543 16:50080058-50080080 CTGGAGGAAGGGAGAGCACAGGG + Intronic
1137687029 16:50393389-50393411 CTGGGGGTAAGAGGGGGACAAGG - Intergenic
1138679740 16:58676165-58676187 CTGGGGGGAAGGATGGAACAGGG - Intronic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139897735 16:70301057-70301079 ATTGGGGAATAGAGGGAACAGGG + Intronic
1140018012 16:71206970-71206992 CTGGGAGAAAGGAAGCAACCTGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1140974486 16:80045768-80045790 CGGGGGGAAAGCAGGGGAGAAGG - Intergenic
1141137712 16:81477506-81477528 CAGTGGGAAAGGAGGGGACCTGG - Intronic
1141177960 16:81733079-81733101 CTGGAGGACAGGAGTGAACCCGG + Intergenic
1141456268 16:84144747-84144769 CCGGGGGAAGAGAGAGAACAGGG + Intronic
1141503901 16:84462421-84462443 CAGGGAGGAAGGAGGGAGCAAGG + Intronic
1141589063 16:85055740-85055762 CTGGGGGAGAGGTGAGAAGAAGG - Intronic
1141984288 16:87570145-87570167 CTGGGGGGCGGGAGGGGACAAGG + Intergenic
1142133482 16:88441382-88441404 GTGGGAGAGAGGAGGGGACAAGG - Intergenic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142747777 17:1968620-1968642 CCCGGGGATGGGAGGGAACATGG - Intronic
1142769309 17:2085258-2085280 CAGGAGGGAGGGAGGGAACAAGG + Intronic
1143388119 17:6543977-6543999 TCGGGGCAAAGGAGGGCACATGG + Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143555112 17:7655113-7655135 CGGGGGGGAAGCGGGGAACAGGG - Intronic
1143577696 17:7804233-7804255 CTGGGGGAAAGAATAGGACAGGG - Intronic
1143714226 17:8755664-8755686 ATGGTGGAGAGAAGGGAACAGGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG + Intergenic
1145921116 17:28610858-28610880 TTGGGGCAAAGGTGGGAATAAGG + Intronic
1146784913 17:35711375-35711397 ACTGGGGAAAGGAGGCAACACGG + Intronic
1147196521 17:38770252-38770274 GTGGGTGAAGGCAGGGAACATGG + Intronic
1147587461 17:41660612-41660634 CTGGGGGATGGGAAGCAACACGG - Intergenic
1147589795 17:41674943-41674965 TTGGGGGCAAGCAGGGAGCAGGG + Intergenic
1148104486 17:45112162-45112184 CTGGGGTAAAGGAGGGCTTAGGG + Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149930173 17:60744113-60744135 CTTGGGGAGAAGAGCGAACAGGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1151539596 17:74758294-74758316 CTGGGGGAAAGGACAGATGAAGG + Intronic
1151629496 17:75300940-75300962 CGTGGGGAAAGGAGGGAAAAAGG - Intergenic
1151722391 17:75864807-75864829 CTGGAGGAGAGGAGGGACCAGGG + Intergenic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1151876887 17:76871955-76871977 CAGGGGGACAGCAGGGAACAAGG - Intronic
1152906537 17:82973624-82973646 CTGGGACACAGGAGGGAACCTGG + Intronic
1152956366 18:45256-45278 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155392442 18:25350871-25350893 ATGGGGGAAAGCGGGGAGCAGGG + Intronic
1155572115 18:27206320-27206342 CTGGAGGAAAGCAGGGAAATTGG - Intergenic
1155656068 18:28194646-28194668 TAGGGGAAAAGAAGGGAACAGGG - Intergenic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156708968 18:39918702-39918724 CTGGCTTAAAGGAGGGAAAAAGG + Intergenic
1156885427 18:42130132-42130154 GTTGGGGAAAGGAGGGAATGGGG + Intergenic
1156958282 18:42993698-42993720 CTGGGGGAAAGGTGGCAATGAGG - Intronic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157697042 18:49731103-49731125 CTGGGGCAAAGGTAGGAACTAGG + Intergenic
1157945566 18:51975862-51975884 TTGGGGGAAAGGGTGGGACAGGG + Intergenic
1158208317 18:55019427-55019449 CTGGGAGAGAGTGGGGAACATGG - Intergenic
1159356114 18:67338437-67338459 AGGGAGGAAAGGAGGGAAGAAGG - Intergenic
1159554230 18:69928498-69928520 CCGGGGGAATGCAGGAAACATGG + Intronic
1159634369 18:70787459-70787481 CTGCGGGGAGGGAGGGAGCAGGG + Intergenic
1159946497 18:74447914-74447936 CTGGAGAAGAGGAGGGACCAAGG + Intronic
1160306796 18:77747565-77747587 CTGCGGGAAAGAAGGAAAGAGGG - Intergenic
1161326344 19:3665995-3666017 CTGGGAGAATGCAGGGAACATGG - Intronic
1161460563 19:4394393-4394415 CAGGCAGAAAGGAGGGAACCAGG + Intronic
1161465593 19:4428604-4428626 ATGGGAGAAAGGAGGCACCATGG - Intronic
1161583460 19:5092902-5092924 CTGCTGGCAAGGAGGGATCAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161875025 19:6901731-6901753 CTGGGAAGAAGGGGGGAACATGG + Intronic
1161934564 19:7363728-7363750 ATGGGTGAAAGGAAGGAAGATGG + Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162573429 19:11485417-11485439 CGCGGGGATAGGAGGGAAGATGG + Intronic
1162925880 19:13930352-13930374 CTGGGGGAGAGGAGGCCACTGGG - Intronic
1163038834 19:14587717-14587739 CTGGGGGAATACAGGGAACGGGG + Intronic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1163160929 19:15463864-15463886 TTAGGGGGAAAGAGGGAACAGGG + Intronic
1163508329 19:17720913-17720935 CTGGTGGGAAGGAGGGATCAAGG - Intronic
1163732168 19:18955460-18955482 CTGGGTGAGAGGAAGGGACAGGG - Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164763080 19:30742887-30742909 GTGGGGGAAATCAGGGAGCAAGG - Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165343310 19:35227547-35227569 CTGGGGGAGAGGAGGGGAAGGGG + Intronic
1165349832 19:35269419-35269441 CAGGGGCACAGGAGGGAGCAGGG - Intronic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165489820 19:36116499-36116521 GAGGTGGAAAGGAGGGAGCAGGG + Intronic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166338437 19:42122670-42122692 CTGGGGGTAAGGGGGGAATTTGG - Intronic
1166412718 19:42567080-42567102 CTGGGGTAAAAGAGGGGATAGGG - Intergenic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166864718 19:45828934-45828956 CTCGGGGACAGGAGGGTGCAGGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167193988 19:48014054-48014076 GCGGGGGCAGGGAGGGAACACGG + Intronic
1167295119 19:48645308-48645330 CTGGGGGGGAGGAGGGAGCTGGG + Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167767959 19:51496834-51496856 CTGGGAGAAAGCAGGGGAGAAGG + Intronic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925631547 2:5898987-5899009 TTGGGGGAGAGGAATGAACATGG - Intergenic
925689373 2:6505618-6505640 GTGGGGTAGAGGAGGGAAGAGGG - Intergenic
925825151 2:7841118-7841140 CTGGGGGAGAGGAGAGACCACGG + Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
925838579 2:7969139-7969161 TTGGGGGAAAAAAGTGAACAGGG + Intergenic
925946001 2:8864579-8864601 TTGGCGGGAAGGAGGTAACAAGG - Intronic
926061504 2:9807761-9807783 CTGGGGCAAAGGAAGGCACAGGG - Intergenic
926065489 2:9836522-9836544 ATGGGGGAAGGAAGGGACCAAGG - Intergenic
927388520 2:22564834-22564856 CTATCAGAAAGGAGGGAACAAGG + Intergenic
927455240 2:23243029-23243051 CTGGCAAAAAGCAGGGAACAGGG + Intergenic
927621017 2:24658887-24658909 CTGGGGGAAGGAAGACAACATGG - Intronic
927757491 2:25720604-25720626 CTGGGGGAAGGCAAGGAACTGGG + Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929897135 2:45971165-45971187 CTGGGAGAAAGGAGGAATCAGGG - Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932475051 2:72000278-72000300 CTGGGGGCAAGGACGAAGCAGGG - Intergenic
932731067 2:74222295-74222317 CCTGGGGAAAGGAGGGAATGAGG + Intronic
933001684 2:76932352-76932374 CTAGGGGAAAGAAGGAGACAAGG - Intronic
933071028 2:77857990-77858012 ATGAGGGAAAGGGGGAAACAGGG - Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
933382203 2:81563174-81563196 TTGGGGGAAAGGGTGGAACAGGG + Intergenic
933669249 2:84991166-84991188 GTAGGGGAAAGGAGGAATCAAGG + Intronic
933997495 2:87680423-87680445 CTGGAGGAGAGGAAGGCACATGG + Intergenic
934084452 2:88498324-88498346 GTGGGGGAAAGGAAATAACAAGG + Intergenic
935124039 2:100207371-100207393 CTGGGGGAAAGAGGGGGCCATGG + Intergenic
935654826 2:105413100-105413122 CTGGTGGAAGGGATGGAACCAGG - Intronic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
936296357 2:111270489-111270511 CTGGAGGAGAGGAAGGCACATGG - Intergenic
936496813 2:113029533-113029555 GTGAGGGAAAGGAGGAATCAAGG + Intronic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936603205 2:113920631-113920653 GTAGGGGAAAGAAGGGAATAGGG - Intronic
937028560 2:118719301-118719323 GTGGGGGAAAGAAGGGAATCAGG - Intergenic
937059447 2:118970677-118970699 CTGGGGGAAAGGTGGTGACTTGG + Intronic
937226262 2:120371762-120371784 CTGGGGGGTGGGAGGAAACAGGG - Intergenic
937324430 2:120981829-120981851 AAGGAGGAAAGGAGGGAGCAAGG - Intronic
937457580 2:122055775-122055797 GTGGGGGAAAGGAGGGGGCAGGG - Intergenic
937880184 2:126858819-126858841 CTGGAGGAAAGCAGGGAGAATGG - Intergenic
939971817 2:148670714-148670736 CGAGGGGAAGGGAGGGGACAGGG - Intronic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
940201178 2:151152726-151152748 ATGGCAGAAAGGAGGGAACGAGG - Intergenic
940340117 2:152571224-152571246 CTGGTGGAGAGGAGGGCCCAGGG + Intronic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
942017767 2:171833730-171833752 GGAGGGGAAAGGAGAGAACAAGG - Intronic
942059592 2:172215783-172215805 TTGGGGGAAAGGAGGGGCCAGGG + Intergenic
943271757 2:185814215-185814237 CTGTGGGAAAGCAGGTAATAGGG + Intronic
944237909 2:197456839-197456861 CTGGGAGAAAGGAAGGGATAGGG + Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
946293357 2:218763074-218763096 CTGGGGGAAGGGATAGGACAAGG + Intergenic
946312714 2:218891867-218891889 CTGAGGGAAAGGAGGGGATGTGG + Intronic
946388415 2:219400359-219400381 CTGGGACACAGCAGGGAACAAGG - Intergenic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
947257218 2:228180544-228180566 CTTGGGGAAAAGAGGGAGTAGGG + Intronic
947661161 2:231869645-231869667 AAGGGGGAAAGGAAGGGACAGGG - Intergenic
947811077 2:233004309-233004331 CAGGTGGAAAGCAGGGAGCATGG - Intronic
948631118 2:239303209-239303231 CCTGGGGACAGGAGGGCACAGGG + Intronic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948869256 2:240790087-240790109 CTGGGGGCAAGGATGGAAGGTGG - Intronic
1168960061 20:1862887-1862909 GAGGAGGGAAGGAGGGAACATGG - Intergenic
1170125631 20:12960320-12960342 CAGGGGGAAAGGATGGGACAGGG + Intergenic
1170132174 20:13032546-13032568 TGGGTGGAAATGAGGGAACATGG - Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170345904 20:15386946-15386968 CAGGGGGAAAGGGGGAAAAAAGG - Intronic
1170519169 20:17165972-17165994 AGGGGGAAAAGGAGGGAACTGGG + Intergenic
1171273179 20:23832341-23832363 CAGGGCGACAGGAGGGAGCAGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1171510842 20:25683354-25683376 CTGGGGGAAATGGGGGAAGGAGG + Intronic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1172233474 20:33352965-33352987 TTGGTGGAAAGCAGAGAACAGGG + Intergenic
1173107652 20:40152784-40152806 TTGGGAGAAAGGAAGGGACATGG + Intergenic
1173408458 20:42788172-42788194 CTGTTGTAAAGAAGGGAACAGGG + Intronic
1173441762 20:43083798-43083820 CTGGGGTAGGGGTGGGAACAGGG - Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173942872 20:46926926-46926948 CTGGGGGAAAGCAGGTGCCATGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174519633 20:51119567-51119589 CTAGGGGAAGGGCTGGAACATGG - Intergenic
1174627610 20:51928231-51928253 GAGGGAGAAAGGAGGGAAGAAGG + Intergenic
1174967873 20:55239802-55239824 CTGGGGGAAAGGAGGGGAAGGGG - Intergenic
1175317278 20:58057779-58057801 TTGGGGGAAAGGAGAGACAAGGG - Intergenic
1175756569 20:61533807-61533829 CTGGTGGGAAGGAGGGAGCCAGG + Intronic
1175843587 20:62047280-62047302 CTCGGGGTAAGGAGGGAGCCTGG - Intronic
1175950336 20:62580289-62580311 GCTGGGGAAAGGAGGGACCATGG + Intergenic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1176551347 21:8223836-8223858 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176570256 21:8406835-8406857 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176578165 21:8451022-8451044 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1176920552 21:14683185-14683207 GAGGAAGAAAGGAGGGAACAGGG + Intergenic
1177527399 21:22312485-22312507 CTGGTGGAAATGAAGGTACAAGG - Intergenic
1178289822 21:31357667-31357689 ATGGGGAAAATAAGGGAACATGG - Intronic
1178667857 21:34564500-34564522 ACTGGGGAAAGGAGAGAACAGGG + Intronic
1179084874 21:38207653-38207675 CGAGGGGAAAGGAGGCAAAAAGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179875058 21:44262975-44262997 GTGGGGGAGAGAAGGAAACAGGG + Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180156216 21:45978352-45978374 GAGGGGGAGAGGAGGGAAGAGGG + Intergenic
1180315255 22:11272131-11272153 CTGGGGGAGAAGCGGGGACAAGG + Intergenic
1180340092 22:11611339-11611361 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180909374 22:19438165-19438187 CTTGGGGGAAGAGGGGAACAGGG - Intronic
1180950786 22:19719580-19719602 CCTGGGGACAGGATGGAACAGGG - Exonic
1181035843 22:20169394-20169416 CTGGGGGGTAGGAGGGGACAGGG + Intergenic
1181047992 22:20224591-20224613 GTGGGGGAGAGGAAGGAACTGGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182545863 22:31076066-31076088 CTGGCGGAAGGCTGGGAACACGG + Intronic
1183049584 22:35250076-35250098 CTGGGTGAAAGGAGGTAAGGAGG - Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183646680 22:39131289-39131311 CTGGGGGAAAGAAAGGCAGATGG + Exonic
1184403588 22:44287531-44287553 GTGGGGGCAAGGAGGCAGCAAGG - Intronic
1184473126 22:44707132-44707154 CTGGGAGCTAGCAGGGAACAGGG - Intronic
1185315430 22:50176916-50176938 CTGGGGGCAAAGAGGAGACACGG - Intronic
1185371146 22:50461479-50461501 CTGGGGGAGAGGGGGCGACAGGG + Intronic
1185399000 22:50606336-50606358 CTGGGGGGCAGTAGGGAGCAGGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203256370 22_KI270733v1_random:140780-140802 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
949247585 3:1943175-1943197 CAGGGGGAAGGGAGAGTACAAGG + Intergenic
949272952 3:2241727-2241749 TTGTGTCAAAGGAGGGAACATGG - Intronic
949374293 3:3370040-3370062 CTCGGGGAAAGGATGGAAGTGGG - Intergenic
950118700 3:10467850-10467872 CTGGGGAAAAGGTGGAGACAAGG - Intronic
950225019 3:11226357-11226379 GTGGGTGAAAGAAGGGAAAAGGG + Intronic
950555343 3:13692433-13692455 CAGGAGGAAAGGAGGCGACATGG - Intergenic
950854470 3:16092192-16092214 CTGGGGTATAGGGAGGAACATGG + Intergenic
951103276 3:18714231-18714253 TTGGGGGAAAAGAGGAATCATGG - Intergenic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952055063 3:29434313-29434335 TTGGAGAAAAGGAGGGAACAAGG + Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953025721 3:39143823-39143845 CAGTGGGAAAGTAGGGACCAGGG + Exonic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953405853 3:42659419-42659441 CTGGGGGCAAGCAGGGGCCACGG + Exonic
953959749 3:47257678-47257700 CTGGGGGAAGGGAACCAACATGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
955340300 3:58120276-58120298 CTTGGGGAAAGGAGTGACAAGGG - Intronic
957295744 3:78330597-78330619 CTGGGGGGAGGTAGGGATCATGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960886130 3:122396944-122396966 GTTGGGGGAAGGAGGAAACAGGG + Intronic
960944009 3:122953573-122953595 GGTGGGGAAAGGATGGAACAGGG + Intronic
961043827 3:123695238-123695260 CTGGGGGATTAGGGGGAACAAGG - Intronic
961222782 3:125212943-125212965 CTGGGGGAAAACAGGGAGTAGGG + Intergenic
961329587 3:126130718-126130740 CTGGTGGAGAGGAGGAACCATGG + Intronic
961611706 3:128144829-128144851 ATGGGGGGAAGGAGGGACCAGGG - Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964769611 3:160210604-160210626 CTGGGGGAAATGAGGCACAAAGG + Intergenic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967055813 3:185827034-185827056 CTGGGGGAAAGAAGAGAAACAGG - Intergenic
967099113 3:186201312-186201334 CTGGGGGCCAGCAGGGATCATGG + Intronic
968196741 3:196712783-196712805 CGGGAGGGAAGGAGGGCACACGG - Intronic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968357969 3:198122990-198123012 CAGGGGTCCAGGAGGGAACAGGG + Intergenic
968554166 4:1238857-1238879 CAGGGGGACAGGAGGGACCCAGG + Intronic
969010085 4:4054860-4054882 CTGGGGGAAAGGGGAGGAGATGG - Intergenic
969297737 4:6279648-6279670 ATGGGAGACAGGAGTGAACAAGG + Intronic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970797796 4:19935060-19935082 CTGGGGGAAGGAAGGGAATGAGG + Intergenic
971018080 4:22508994-22509016 TTGGGAGAAAGGGTGGAACATGG - Intronic
971028747 4:22613786-22613808 CACAGGGAAAGGAGGGAATATGG + Intergenic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972672363 4:41225946-41225968 CTTGGGGGAAGGGGGGAATAGGG + Intergenic
973030920 4:45337730-45337752 CTGGATGAAATGAGAGAACATGG - Intergenic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
973919150 4:55667126-55667148 CTGGGGGGCAGGAGGGAATGGGG - Intergenic
974349380 4:60724671-60724693 CTGGGGGAAAGCAGGGAATAAGG - Intergenic
975343370 4:73266097-73266119 GTTGGGTAAAGAAGGGAACAAGG + Intergenic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976512534 4:85928311-85928333 CGGGAGGAAAGGAGGGAAGGAGG - Intronic
976708211 4:88041204-88041226 GTTGGGGCAAGGAGGAAACATGG - Intronic
976849969 4:89533677-89533699 CTGGGGTAAGGGTGGGAGCAAGG - Intergenic
976938289 4:90666813-90666835 GTGGGGGAGAGGAGGAATCAGGG + Intronic
978592471 4:110340421-110340443 GTGGGGAGAAGGAGGGACCAGGG - Intergenic
979255303 4:118602018-118602040 AAGGAGGAAAGGAGGGAAAAAGG - Intergenic
980762460 4:137253759-137253781 CTGGGGTAAGGGAGGGGCCAAGG - Intergenic
981108347 4:140906486-140906508 TTGGGGGAAAGGGGGTATCATGG + Intronic
982046283 4:151449682-151449704 CTTGGGGAAAGGATGGGAGAGGG - Intronic
982744108 4:159088438-159088460 CTGGGGGAAGGAAAGGAGCAGGG + Intergenic
983204922 4:164902126-164902148 CTGGGAGCCAGGAGGGAGCAAGG - Intergenic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984849461 4:184141426-184141448 CTGTGGGGAAGGCGGCAACAAGG + Intronic
985899975 5:2780655-2780677 CTGGGGCAAAGGAGGACTCAGGG - Intergenic
985962889 5:3316255-3316277 CTGGGGGACAGGAGGAGATAGGG - Intergenic
985993802 5:3585033-3585055 ATGGGAGAAAGGAAGGAAGAAGG + Intergenic
986168662 5:5297569-5297591 ATGGGGGAAAGACAGGAACATGG - Intronic
986445401 5:7816513-7816535 GGAGGGGAAAGGAGGGAAGAAGG + Intronic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988578056 5:32445130-32445152 CTGCGGGAAAGCAGGAAATAAGG - Intergenic
988999918 5:36749330-36749352 TTGGGGGAAAGGAGAGAAATGGG - Intergenic
989092754 5:37751061-37751083 CAGGGGGAAAAAAAGGAACAAGG - Intronic
990346248 5:54874586-54874608 CTGGGGAAAAGCAAGGAACTAGG + Intergenic
990887206 5:60608087-60608109 CAAGGGGAAAGCAGGGAAAAAGG + Intronic
991300322 5:65123425-65123447 AAGGGGGAAAGGATAGAACAAGG - Intergenic
991743657 5:69709543-69709565 GTGGGGGAAAGAGGGGAGCATGG + Intergenic
991795230 5:70289275-70289297 GTGGGGGAAAGAGGGGAGCATGG + Intergenic
991833368 5:70720812-70720834 GTGGGGGAAAGAGGGGAGCATGG - Intergenic
992199174 5:74367366-74367388 CTGGGATACAGGAGGGAACCGGG + Intergenic
992788633 5:80193796-80193818 CTGAGGCATAGGAGGGTACAGGG + Intronic
993543531 5:89182518-89182540 TCTAGGGAAAGGAGGGAACAGGG - Intergenic
993836200 5:92823085-92823107 CAGGAGGGAAGGAGGGGACAAGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994099821 5:95880445-95880467 TTGGGGGAAAGAACGGAACATGG - Intergenic
994165924 5:96608107-96608129 CTGGGGGAAGGGTGTGGACAGGG - Intronic
994286962 5:97980793-97980815 GTGGGGGAAAGAAGAGAAAATGG + Intergenic
994625995 5:102219793-102219815 CTGGGGGAAAGGGTGGGAGAGGG - Intergenic
995131767 5:108638079-108638101 TAGGGGGGAAGGAGGGAACATGG + Intergenic
995193041 5:109339931-109339953 CTGGGAGAAGGGAGAGAGCAAGG + Intronic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995381824 5:111543815-111543837 CAGGAAGGAAGGAGGGAACAAGG - Intergenic
995820460 5:116224535-116224557 CATGGTGAGAGGAGGGAACAAGG + Intronic
996351192 5:122543731-122543753 TTGGGGGAAAAGAGAGATCATGG - Intergenic
996551882 5:124739467-124739489 CTGGAGGCAAGGAGGGGAAAAGG - Intronic
996594827 5:125188361-125188383 CTGAGAGAAAGAAAGGAACATGG - Intergenic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998385412 5:141754510-141754532 CTGGGGGTATGGAGGAACCAAGG - Intergenic
998499657 5:142621387-142621409 GTGGAGGAAAGGAGGGAAGGAGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998778865 5:145633903-145633925 CTATGGGAATGCAGGGAACATGG - Intronic
999762669 5:154714650-154714672 CTGCAGGAAAGGAGAGAACAGGG - Intronic
999799956 5:155024214-155024236 CTGGGGCAAAGGAAGTAACTGGG - Intergenic
999904021 5:156119620-156119642 CTGGGGGAAAGGATGAACTATGG - Intronic
999940688 5:156539406-156539428 TTGGGGGAAAGGATGGAAGGGGG - Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001558744 5:172655339-172655361 GAGGGGGAAAGGAGGGAAACAGG - Intronic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1003052828 6:2795671-2795693 CAGGGGGAGAGGAAGGCACAGGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003734453 6:8862748-8862770 ATGAGGGAAATGAGAGAACATGG + Intergenic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1004029494 6:11852449-11852471 GTGGAGGAGAGGAGGGAGCAGGG + Intergenic
1004129010 6:12901431-12901453 TTGGAGGAAAGGAGGAAAGAGGG + Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005759442 6:28954263-28954285 CTGGGGCAGGGGTGGGAACAAGG - Intergenic
1005826115 6:29632727-29632749 CTGGGGGAGAGGAGGAACCGCGG - Intronic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006143068 6:31942677-31942699 CTGGGGGGGAGGAGTGAACTAGG + Intronic
1006416410 6:33906819-33906841 CTGGGAGAAGGGTGGGACCAGGG + Intergenic
1006450964 6:34105499-34105521 CTGAGAGGAAGGAGGGGACAAGG - Intronic
1007289568 6:40775214-40775236 CTGGGAGCAAAGAGGGAACTTGG - Intergenic
1007533627 6:42564654-42564676 CTGGGGGAAAGGAGGTATGATGG - Intronic
1007695799 6:43733777-43733799 CACGGGGAGAGGAGGGAGCAAGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1009299574 6:61997751-61997773 CTGGGAGTTAGTAGGGAACAAGG - Intronic
1009437806 6:63636922-63636944 CTGAGGGAAAGGAGGGACACAGG - Intronic
1009576435 6:65468009-65468031 TTTGGGGAAAGGAGCAAACAGGG - Intronic
1010009126 6:71029430-71029452 TGGGGGCAAAGGAGGGAAAATGG - Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1010366815 6:75060602-75060624 CTAGGGGGAAGGAAGGAAAAAGG - Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1010949429 6:82017495-82017517 CTGGGAGAAGGGAGGGCTCAGGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013016285 6:106163501-106163523 CTGGAGGAAAGGAGTGAGCCAGG - Intergenic
1013797162 6:113900727-113900749 CTGGTGGAAAGGAGAGGCCAGGG - Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014748457 6:125228211-125228233 TTGGGGGAAAGGAAAGAAGAGGG + Intronic
1014882219 6:126737238-126737260 CTTGTGGAATGGAGAGAACAGGG - Intergenic
1015054617 6:128884824-128884846 CTGGGAGAAATGAGGGGCCAGGG + Intronic
1015296751 6:131603586-131603608 CTTGGGGGTAGGAGGAAACAAGG - Intronic
1015413392 6:132920386-132920408 CTGGGGGTCAGGAGGAAACGAGG - Intergenic
1015658456 6:135546545-135546567 GAAGGGGAAAAGAGGGAACAGGG + Intergenic
1015774074 6:136795901-136795923 CGGGAGGGAAGGAGGGAGCAAGG - Intergenic
1017566460 6:155692468-155692490 CTGGTGGAAAGAGGAGAACAGGG + Intergenic
1017758649 6:157551207-157551229 CAGGAGGAAGGGAGGGGACACGG - Intronic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1018559400 6:165085791-165085813 CTGGGGGAAAAGATAGAACAGGG + Intergenic
1018839639 6:167508372-167508394 ACAGGGGAAGGGAGGGAACAGGG - Intergenic
1019004630 6:168785975-168785997 AAGGGGGAAGGGAAGGAACATGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019272338 7:157189-157211 CTGGAGGGAAGGAGGGGACAGGG + Intergenic
1019437362 7:1028896-1028918 CTGGGGGAGATGGGGGGACATGG - Intronic
1019534910 7:1523829-1523851 GTCGGGGAAAGGAAGGGACACGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019714272 7:2531103-2531125 CAGAGGGAAAGCAGGGACCAGGG + Intergenic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019718069 7:2550714-2550736 CTGGGAGGGAGGAGGAAACAGGG + Intronic
1019781673 7:2944060-2944082 GTGGGGGAATGGAGGACACAGGG - Intronic
1019999099 7:4744772-4744794 CTGGGCGGAAGGAGGGGAAAGGG - Intronic
1020439483 7:8201988-8202010 CTGGGGGTAGGCAGGGGACATGG - Intronic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1021763172 7:23921193-23921215 CTGGGGGGAAGGATGTAAAAGGG + Intergenic
1021848712 7:24787257-24787279 CACAGGGGAAGGAGGGAACATGG + Intergenic
1021948785 7:25754122-25754144 CTTGGGGAAAGCGGGGAGCAAGG - Intergenic
1022469843 7:30675320-30675342 CTGGTGGTAAGGAGTGCACAGGG + Intronic
1023225989 7:37969579-37969601 CTCTGCGATAGGAGGGAACATGG + Intronic
1023258402 7:38334835-38334857 CTGGGGGAGGGTGGGGAACAAGG + Intergenic
1023259062 7:38340497-38340519 CTGGGGGAGGGTGGGGAACAGGG + Intergenic
1023260468 7:38353510-38353532 CTGGGGGAGGGTGGGGAACAGGG + Intergenic
1023261442 7:38362659-38362681 CTGGGGGAGGGTGGGGAACAGGG + Intergenic
1023261945 7:38367396-38367418 CTGGGGGAGGGTGGGGAACAGGG + Intergenic
1023488336 7:40710954-40710976 CTGGGGTAAAGGAAGGAATTGGG + Intronic
1023528294 7:41128094-41128116 CAGGAGGAAAGGAGAGAACAGGG + Intergenic
1023897406 7:44445406-44445428 CTAGGGGAAGGGAGTGAACAGGG - Intronic
1024575836 7:50763621-50763643 CTGGGGGAGAGGAGGGATTTGGG - Intronic
1024804147 7:53116775-53116797 CTGGGGGAGAGGAGGGCATATGG + Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026760574 7:73122954-73122976 CTTGGGGAAAGGGGGGATCCAGG + Intergenic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1027228250 7:76258272-76258294 CTGGAGGAAAGGAGGGGAAGCGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029379608 7:100204582-100204604 ATGTGGGAAAGGGAGGAACACGG - Intronic
1029599179 7:101553779-101553801 CTGGGGGACTGAAGGGGACAGGG + Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030060679 7:105618566-105618588 CTGGGGGAGAGGAGGAATCCTGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1031954575 7:127929382-127929404 CAGGGGGAAAGGAGGGTATGTGG - Intronic
1032623151 7:133558860-133558882 CTGGAGGATAGGTGGGCACAGGG - Intronic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033668960 7:143471492-143471514 TTGGGGTAAAGGAGGGAAGGAGG + Intergenic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034279553 7:149843601-149843623 CTCGGGGAAAGGATCTAACAGGG - Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1036022544 8:4862127-4862149 CTGGGGACAAGGAGGCATCAGGG + Intronic
1036867916 8:12416839-12416861 CTGGGGAAAACGAGGGGCCATGG - Intergenic
1037268391 8:17095718-17095740 AAGGAGGAAAGGAGGGAAAAAGG - Intronic
1037405721 8:18540680-18540702 TGGAGGGCAAGGAGGGAACAGGG - Intronic
1037580086 8:20239900-20239922 CCGGAGGAAAGAAAGGAACAAGG - Intergenic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1039254541 8:35704769-35704791 CAGGGGGAATGGGGAGAACAGGG + Intronic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040720417 8:50314439-50314461 CTAGAGTAAAAGAGGGAACAGGG - Intronic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041032605 8:53753421-53753443 CAGGGAGAAAGAAAGGAACAGGG + Intronic
1041143113 8:54843734-54843756 CTGGAGCAAGGGTGGGAACAAGG - Intergenic
1042586848 8:70349008-70349030 GTGGGGGATGGGAGGGAAAAGGG + Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045605692 8:103771565-103771587 ATGGGGAAAAGGTGAGAACAGGG - Intronic
1045717746 8:105068099-105068121 GTGGGGGAAATGAGAGAAAAGGG - Intronic
1046568560 8:115933003-115933025 CTGGCAGAAAGGAGGGCACCTGG + Intergenic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048019489 8:130525409-130525431 GTGGGGGAAATGAGAGAACATGG - Intergenic
1048370842 8:133774899-133774921 CAGGGGGAAGGTGGGGAACATGG - Intergenic
1048513271 8:135081159-135081181 ATGAGGGAAAGGAGGGAAAGGGG + Intergenic
1048905457 8:139083926-139083948 CTGTGGGGAATGAGGGAATAAGG - Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049400965 8:142427056-142427078 CTGGAGGAATGGAGGCCACATGG - Intergenic
1049565905 8:143338880-143338902 CTGGGGAAGAAGAGGGCACAAGG - Intronic
1050697007 9:8290769-8290791 CTGAGAGAAAGGAGGCTACAGGG + Intergenic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1052031199 9:23630832-23630854 ATGGGAGAAAGGAGAGAACTAGG + Intergenic
1052053646 9:23879486-23879508 GTCAGGGAAAGGAGGGAATAGGG - Intergenic
1052996465 9:34553902-34553924 CTCGGGGGAAGGTTGGAACAGGG - Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053355961 9:37445738-37445760 ATGGGGAAAAGGATGGGACAGGG + Intronic
1053365086 9:37517206-37517228 CAGGGGGAAGGGTGGGAGCAGGG + Intronic
1055335000 9:75224460-75224482 CAGGGGGAAAGGAGGGGAAGGGG - Intergenic
1056679925 9:88708246-88708268 CTGGTGGAAAGTAGGGGAAAGGG + Intergenic
1057040954 9:91847073-91847095 CGGGGGGAAATGGGGGAAGATGG + Intronic
1057293973 9:93824804-93824826 CTGGGGGAAGGGAGGGCACTCGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1057794956 9:98148978-98149000 CTGGGGTTAAGGAGGGAATGGGG + Intronic
1058087916 9:100770220-100770242 TTGGGGGAAAGGATGGAAGGGGG - Intergenic
1058104852 9:100957950-100957972 ATGGGGTAAAAGAGGGAACTGGG + Intergenic
1058439068 9:104991092-104991114 CTGGAGGAGAGGAGCTAACAAGG + Intergenic
1058983234 9:110189360-110189382 ATGGGGGAAAGGAGGTGGCAGGG - Intergenic
1059354307 9:113687345-113687367 GGTGGGGAAAGGAGGGAAGAGGG + Intergenic
1059429788 9:114243215-114243237 GTGAGGGAAAGGAAGGAACTTGG - Intronic
1059450922 9:114371017-114371039 CTGGGGGGGAGGTGGCAACATGG + Intronic
1059613535 9:115924582-115924604 ATTGGGGAAAGGAGGAAAGAAGG + Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060851052 9:126876183-126876205 GGGGGGGAAAGGAGGGAAGGGGG - Intronic
1061014220 9:127972648-127972670 CTGGAGGCAGGGAGGCAACAAGG + Intronic
1061244737 9:129395653-129395675 ATGGGAGAAAGGATGGAAGATGG + Intergenic
1061408424 9:130405283-130405305 CCTGGGGAAGGGAGGGAACTCGG + Intronic
1061547169 9:131311113-131311135 CTGGTGGCAAGGAAGGAACTGGG + Intergenic
1061678729 9:132232215-132232237 CTGGGGGCCAGGTGGGGACAGGG - Intronic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062305752 9:135906667-135906689 CTGGGCGCAGGGAGGGACCATGG - Intronic
1062715864 9:138009811-138009833 CTGGAGGTGAGGATGGAACAGGG + Intronic
1062741837 9:138179523-138179545 CAGGGGCCCAGGAGGGAACAGGG + Intergenic
1203472526 Un_GL000220v1:122480-122502 CTGGGGGAGAAGCGGGGACAAGG - Intergenic
1185449610 X:275393-275415 CTGGGGTGAGGGAGGAAACAGGG + Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1185838043 X:3363275-3363297 CTGGGAGAAAGGAGGACACCGGG + Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186810937 X:13187900-13187922 CTGGGGGAAGAGAAGAAACAGGG - Intergenic
1186938115 X:14473567-14473589 ATAGGGGAAAGGAGGAAACCTGG - Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187197905 X:17105743-17105765 GTGGGTGAAAGGAGGGAATAGGG - Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188589424 X:31815613-31815635 TTGGGGAAAAGGAGGGAAACTGG - Intronic
1190217558 X:48490050-48490072 CTGAGGAAAAGGAGGGAGCCGGG + Intergenic
1190454100 X:50608734-50608756 CTGGGTGATAGGTAGGAACATGG - Intronic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192615122 X:72612315-72612337 CTGGGGGAATGGAGGGATTGGGG + Intronic
1192888056 X:75358036-75358058 CTGGTGGAGCGGAGGGAAAATGG + Intergenic
1193304831 X:79936231-79936253 TTTGGGGAAGGGAGGGAAAAGGG - Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193541494 X:82778220-82778242 CTGGGGGAGAGGGGGAAACAAGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195377310 X:104240318-104240340 CTGGGTGAAAGGGGAGAAAATGG + Intergenic
1195669041 X:107453693-107453715 GGGGAGGAAAGGAGGGAAAATGG - Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1195926580 X:110031758-110031780 TAGGGGGAAAGGAGGGATTAGGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196401906 X:115325641-115325663 GGGGGGGAAAGGAGGGAAAGGGG - Intergenic
1196785681 X:119419619-119419641 CTGTGGGAAATGTGGGACCATGG - Intronic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199827511 X:151515325-151515347 ATGGGGAAGAGGAGGGGACAAGG - Intergenic
1199827625 X:151515820-151515842 ATGGGGGAGGGGTGGGAACAGGG - Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1201074769 Y:10178798-10178820 CTGGGGGAGAAGTGGGGACAAGG - Intergenic
1201221438 Y:11774420-11774442 CTGGGGGCAAGAATGGGACATGG + Intergenic
1201229927 Y:11854308-11854330 TTGGGGGAAAGGAGGAAAGGTGG - Intergenic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201550080 Y:15210281-15210303 ATGAAGGGAAGGAGGGAACAAGG + Intergenic
1201862209 Y:18611353-18611375 CTGGGGTAAAGGAGTCATCAGGG - Intergenic
1201863099 Y:18621176-18621198 CTGGGGTAAAGGAGTCATCAGGG - Intergenic
1201870224 Y:18699202-18699224 CTGGGGTAAAGGAGTCATCAGGG + Intergenic
1201871114 Y:18709027-18709049 CTGGGGTAAAGGAGTCATCAGGG + Intergenic