ID: 1006092688

View in Genome Browser
Species Human (GRCh38)
Location 6:31637278-31637300
Sequence GGTGCGGAAGACTCCACTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006092688_1006092696 22 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092696 6:31637323-31637345 AGGTGAAGGAGAAACCCTTGTGG 0: 1
1: 0
2: 0
3: 31
4: 314
1006092688_1006092693 8 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092693 6:31637309-31637331 CGACCTTTACCAGCAGGTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 64
1006092688_1006092692 2 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006092688 Original CRISPR GGTGCGGAAGACTCCACTGT AGG (reversed) Exonic