ID: 1006092688

View in Genome Browser
Species Human (GRCh38)
Location 6:31637278-31637300
Sequence GGTGCGGAAGACTCCACTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006092688_1006092692 2 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092688_1006092693 8 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092693 6:31637309-31637331 CGACCTTTACCAGCAGGTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 64
1006092688_1006092696 22 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092696 6:31637323-31637345 AGGTGAAGGAGAAACCCTTGTGG 0: 1
1: 0
2: 0
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006092688 Original CRISPR GGTGCGGAAGACTCCACTGT AGG (reversed) Exonic
900872185 1:5312019-5312041 GGTGGGGGATACTCCTCTGTGGG - Intergenic
903122421 1:21225066-21225088 GGTGGGGGAGCCTCCACGGTCGG + Intronic
908246439 1:62230974-62230996 GGGCTGGATGACTCCACTGTGGG + Intergenic
923680295 1:236113338-236113360 GGTCCTGAACACTCCACTGTGGG - Intergenic
1067981950 10:51097037-51097059 TTTGGGGAAGACCCCACTGTAGG - Intronic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1085265604 11:75236294-75236316 GGGACGGGAGACTTCACTGTGGG - Intergenic
1087750882 11:102005650-102005672 GGTGGTGAAGCCTCCCCTGTGGG - Intergenic
1089218933 11:116854578-116854600 GTTGCACAAGACTCTACTGTAGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1091671623 12:2456345-2456367 GTTGTGGGAGACTCCCCTGTCGG - Intronic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1099019410 12:77384787-77384809 GGTGCAGAAAACTCCTCTGGAGG + Intergenic
1102536510 12:113585553-113585575 TGTGCGGAAGACTCAGCTGTTGG + Intergenic
1106188289 13:27427619-27427641 GGTGCAGAAGAGTCCTCTTTAGG + Intronic
1113497946 13:110748033-110748055 GGTTCAAAAGGCTCCACTGTGGG + Intergenic
1113982705 13:114289591-114289613 TGTGCAGAAGAATCCACTGGAGG - Intronic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1125465816 15:39951354-39951376 CGTGCTTAAGAATCCACTGTGGG - Intronic
1128599892 15:68987410-68987432 GGAGAGGAAGCCTCCACAGTGGG - Intronic
1129833475 15:78685881-78685903 GGTGCAGATGACTCCACCGACGG - Intronic
1130880609 15:88052551-88052573 TGTAGGGAAGACTCCACTCTTGG - Intronic
1132227038 15:100150737-100150759 CCTGCGGAGGACTCCACAGTGGG + Intronic
1139359441 16:66388353-66388375 GATGCAGACGACCCCACTGTGGG + Exonic
1139615380 16:68085440-68085462 GGTGCCTAAGCCTCCACTGTCGG - Intronic
1140043171 16:71422921-71422943 GGTCCAGAAGATTCCACAGTGGG - Intergenic
1144455919 17:15418190-15418212 GGTGGGGCAGACACCCCTGTAGG - Intergenic
1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG + Intronic
1153444386 18:5155292-5155314 GGGGCTGAAAACTCCACTCTGGG + Intronic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1157856442 18:51109537-51109559 GGTGCGAAATATTCCACCGTGGG + Intergenic
1160229335 18:77034578-77034600 GCAGCGGGAGGCTCCACTGTGGG - Intronic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG + Intronic
1168131363 19:54321820-54321842 GCTGCCCAGGACTCCACTGTGGG - Intergenic
925959544 2:9003133-9003155 GGTGCGGAAGGCTGCGCTTTGGG - Intronic
929453430 2:42050905-42050927 GGGCAGGAAGACCCCACTGTAGG - Intronic
941376029 2:164731926-164731948 GGTGGGGAAGGATTCACTGTCGG + Intronic
948535607 2:238644173-238644195 GGTGCCTTAGGCTCCACTGTTGG + Intergenic
948868065 2:240785288-240785310 GGGGCTGAGGACGCCACTGTGGG - Intronic
948936487 2:241168505-241168527 GTTGCAGAAGACGCGACTGTGGG - Intronic
949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG + Intergenic
1169164222 20:3408026-3408048 GGAGCGGAAGACTTCGCTGGAGG - Intergenic
1173183142 20:40819685-40819707 AGTGCGTAAGACTCCATTGTGGG - Intergenic
1173837523 20:46135712-46135734 GGTGCATAGGATTCCACTGTAGG + Intergenic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1181714219 22:24712528-24712550 GGTGGGGGAGACTCCATTCTTGG + Intergenic
956577179 3:70764840-70764862 GGTGGGAAAGGCTCCTCTGTAGG + Intergenic
960181798 3:114588741-114588763 GGCACGGAACTCTCCACTGTAGG + Intronic
982946426 4:161629992-161630014 TCTGAGGAAGACTCCACTATAGG - Intronic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
987009963 5:13752456-13752478 GGTGTGGAATTTTCCACTGTGGG - Intronic
988484226 5:31655073-31655095 AGCACGGAAGACTCCACTGATGG - Intronic
999282043 5:150372379-150372401 GGAGTGCAAGACTCCCCTGTGGG - Intronic
999722304 5:154407806-154407828 AGTGCTGAAGAGTCCACAGTGGG - Intronic
1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG + Intergenic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1016181774 6:141155610-141155632 CTTTCGGAAGACTCCACCGTTGG - Intergenic
1022747060 7:33183205-33183227 GGTGCTGCAGACTCCATTTTGGG - Intronic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1042858812 8:73294201-73294223 GCTGCGGAAGACAGCCCTGTGGG - Intronic
1044957716 8:97498715-97498737 GATGTGGAAGAGTCCACTGGAGG - Intergenic
1046958653 8:120086905-120086927 GGTTAGGCTGACTCCACTGTAGG + Intronic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1053071767 9:35106112-35106134 GGTGAGGAGAACTCTACTGTAGG - Intronic
1056994784 9:91445655-91445677 GGGGCGCAAGACTGCTCTGTAGG + Intergenic
1186451313 X:9676169-9676191 GGTGCTGGAGACCACACTGTAGG + Intronic
1198634644 X:138682501-138682523 GGTTTGGAAGACTGCACTGTAGG - Intronic