ID: 1006092692

View in Genome Browser
Species Human (GRCh38)
Location 6:31637303-31637325
Sequence GCGCGTCGACCTTTACCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 2, 2: 1, 3: 0, 4: 9}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006092682_1006092692 26 Left 1006092682 6:31637254-31637276 CCCGTCTCAAGGCCACGCCTTCC 0: 2
1: 1
2: 1
3: 14
4: 176
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092688_1006092692 2 Left 1006092688 6:31637278-31637300 CCTACAGTGGAGTCTTCCGCACC 0: 1
1: 1
2: 1
3: 8
4: 61
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092683_1006092692 25 Left 1006092683 6:31637255-31637277 CCGTCTCAAGGCCACGCCTTCCA 0: 1
1: 0
2: 2
3: 21
4: 184
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092687_1006092692 5 Left 1006092687 6:31637275-31637297 CCACCTACAGTGGAGTCTTCCGC 0: 1
1: 1
2: 1
3: 8
4: 57
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092686_1006092692 9 Left 1006092686 6:31637271-31637293 CCTTCCACCTACAGTGGAGTCTT 0: 1
1: 2
2: 2
3: 21
4: 221
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9
1006092685_1006092692 14 Left 1006092685 6:31637266-31637288 CCACGCCTTCCACCTACAGTGGA 0: 1
1: 1
2: 3
3: 12
4: 135
Right 1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG 0: 1
1: 2
2: 1
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006092692 Original CRISPR GCGCGTCGACCTTTACCAGC AGG Exonic
904045202 1:27604331-27604353 GCGCGTCCTCGTTTACCAACGGG + Intronic
1113280175 13:108779834-108779856 GAGGGTCCTCCTTTACCAGCTGG - Intronic
1151685767 17:75645875-75645897 GCTCCTAGATCTTTACCAGCTGG + Intronic
1162926016 19:13930811-13930833 GGGCGTCGACCTGGCCCAGCTGG + Exonic
1162955785 19:14097219-14097241 GCGCGTCCAGCTTCACCACCTGG + Intronic
954940708 3:54369658-54369680 GCGTGTCGGCCTTTCCCACCTGG + Intronic
1001370514 5:171195742-171195764 GCTCGCTGACATTTACCAGCTGG + Intronic
1003635991 6:7832025-7832047 GCGTGTCTACCTTAACCTGCTGG - Intronic
1006092692 6:31637303-31637325 GCGCGTCGACCTTTACCAGCAGG + Exonic
1026067674 7:67089397-67089419 GCGCTTCGACCTTTACCAGCAGG - Intronic
1026709251 7:72722934-72722956 GCGCTTCGACCTTTACCAGCAGG + Intronic
1059135571 9:111803277-111803299 GCGCATCGACCTTCACCAGCAGG + Intergenic
1199857705 X:151773683-151773705 TCGCGACCACCTTTACCACCAGG + Intergenic