ID: 1006093346

View in Genome Browser
Species Human (GRCh38)
Location 6:31641146-31641168
Sequence CCCCAAGCAGTGCAGGTTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006093339_1006093346 12 Left 1006093339 6:31641111-31641133 CCATTGATAACAGCAGCAAGCTC 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 103
1006093340_1006093346 -10 Left 1006093340 6:31641133-31641155 CCATCTGCTGTCCCCCCAAGCAG 0: 1
1: 0
2: 0
3: 15
4: 250
Right 1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006093346 Original CRISPR CCCCAAGCAGTGCAGGTTTA GGG Exonic
905008409 1:34729773-34729795 CCCCAAACAGTGCAGGTGGATGG - Intronic
907084840 1:51661974-51661996 TCTCAAGCAGTTCTGGTTTAAGG - Intronic
908341230 1:63181499-63181521 CCCCAATAAGGGCAGGTTTGGGG + Intergenic
912206265 1:107512617-107512639 CTCCAAGCAGGGGAGGTATATGG - Intergenic
916240546 1:162634719-162634741 CCCAAAGCAGTGCAGGCTGAAGG + Intronic
919140320 1:193562297-193562319 ACCCAAGGAATGCAGGTTGATGG + Intergenic
920262273 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG + Intergenic
1067523381 10:47024524-47024546 CCCCAGGCTGTGCAGCTGTACGG - Intergenic
1074507249 10:114082410-114082432 CCCGAGGCAGTGCCGGTATAAGG - Intergenic
1075668509 10:124247323-124247345 ACCGAAGAAGTTCAGGTTTAGGG - Intergenic
1076778156 10:132709479-132709501 CCCCAGGCAGTGCAGGCTGCAGG + Intronic
1077251247 11:1561664-1561686 CCCACAGCAGGGCAGGTTTGCGG - Intronic
1077510075 11:2954758-2954780 CCCCCAGCAGTGCAGGAGTTTGG - Intronic
1081862651 11:46342307-46342329 CGCCAAGGAGTGCAAGTTCAAGG + Intronic
1083901124 11:65644091-65644113 CCCCCAGGAGTGGTGGTTTAAGG + Intronic
1084042645 11:66551233-66551255 CACCAGGCAGTGAAGGTCTAGGG - Exonic
1085730759 11:78996674-78996696 ACCCAAGCAGTGCTGCTTTGGGG + Intronic
1088392291 11:109327879-109327901 CCCAAGGCATTGCAGGTTCATGG - Intergenic
1089787347 11:120917515-120917537 CCCCGAGCAGGGCAGGACTAAGG + Intronic
1097695285 12:62769248-62769270 CCCCAAGTGGTGCAGGTTTGTGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102505088 12:113379499-113379521 CCCCATGCAGGGCGGGTATAAGG + Intronic
1111712880 13:91839628-91839650 CCCAAAGCATTGCAGGATGAAGG - Intronic
1112396986 13:99042508-99042530 CCCCAGACAGAGCAGGTTTAGGG + Intronic
1112652864 13:101417151-101417173 CTCCCAGCAGAGCAGGTTTAGGG + Intergenic
1113819475 13:113203052-113203074 TCACAAGCAGTTCAGGATTAGGG - Intronic
1117600193 14:57366420-57366442 CCCCTAGCACTGCTGGGTTAGGG + Intergenic
1119644615 14:76339452-76339474 CCCCAAGAGGTGCAGGTGGAAGG - Intronic
1120215732 14:81679382-81679404 CCCCCAGCAGTGCTGGCTCATGG - Intergenic
1121645579 14:95515684-95515706 CCCCACCCAGTGCAGGGATAAGG + Intergenic
1121832520 14:97064295-97064317 TTCCTAGCTGTGCAGGTTTAGGG + Intergenic
1124987675 15:34637955-34637977 CCCAAAGCATTGCAGGATGAAGG - Intergenic
1125579252 15:40774081-40774103 CCCCAAGGGGTGCAGGTGGAGGG + Intronic
1125735891 15:41925698-41925720 CCCCAAGCTGTGTAGCTTTTGGG - Intronic
1128675267 15:69603855-69603877 CCCCAAGCACTTCAGGCTCAGGG - Intergenic
1132258581 15:100401116-100401138 CCCCAAGCAGAGCAGCTGCAGGG - Exonic
1136458930 16:30398070-30398092 CCGCAATCAGTGCAGATATATGG - Exonic
1137382045 16:48008468-48008490 CCCCACACAGTGCAGGCTTGTGG - Intergenic
1144109352 17:12017325-12017347 CTGCAAGCTGTGCAGGTTTCTGG - Intergenic
1148176988 17:45575127-45575149 ACCCAAGCTGTGCAGGATTTAGG + Intergenic
1150748358 17:67835442-67835464 ACCCAAGCTGTGCAGGATTTAGG - Intronic
1151346603 17:73506426-73506448 GCCCATGCAGTCCAGGGTTAAGG + Intronic
1152492651 17:80648051-80648073 CCCCAAGCAGAGTATGTTCAAGG + Intronic
1156554220 18:38048970-38048992 CCACAATCAATGCAAGTTTATGG - Intergenic
1157318650 18:46617181-46617203 CCACATGCAGTGCAGGCCTAAGG + Intronic
1163839158 19:19595343-19595365 CCCCAAGTACTGCAGGCTGAGGG - Intronic
927350940 2:22113756-22113778 CCCTAAGCAATGCAAGTGTAAGG - Intergenic
935157672 2:100497496-100497518 CCCCAAGAAGTGGACATTTAGGG - Intergenic
936155694 2:110046254-110046276 CCCCAAGTAGTTCATGTTTCTGG - Intergenic
936188994 2:110325179-110325201 CCCCAAGTAGTTCATGTTTCTGG + Intergenic
946594298 2:221289010-221289032 ACCCACACAGAGCAGGTTTAAGG - Intergenic
948831240 2:240599244-240599266 ACCCAGGCAGGGCAGGTTTCAGG + Intronic
1171725877 20:28620549-28620571 CCCCAAGCAGGGCCAGCTTAGGG + Intergenic
1174148483 20:48469147-48469169 CCCCAGGCAGAGCAGGTCTCAGG + Intergenic
1174193148 20:48754565-48754587 CCCCAAGCAGATCAGGTTGCCGG - Intronic
1178737182 21:35162768-35162790 TCCCAAGCAGGGTAGGTTTGGGG + Intronic
1179453230 21:41479857-41479879 CCCCAGGCAGTGCTGGTAAATGG + Intronic
1180132158 21:45833778-45833800 CCCCATGCAGGGCAGGGTCACGG + Intronic
1180960852 22:19761591-19761613 CCCCAAGCCGGGCCGGTTTCTGG - Intronic
1182915413 22:34024770-34024792 CCACAGGCAGTGCAGGCTCAGGG + Intergenic
1183409177 22:37644990-37645012 CCCCGAGCAGGGCAGGGTCAGGG - Intronic
1185097342 22:48818182-48818204 CCCAAAACAGTTCCGGTTTATGG + Intronic
949157786 3:849151-849173 CCCCACACAGTGCAGGTCTGGGG - Intergenic
950424331 3:12916525-12916547 CCCCAAGCACTGCAGCCTTTTGG - Intronic
951723789 3:25732375-25732397 CCCCAAGTTCTCCAGGTTTAGGG + Exonic
954130932 3:48560644-48560666 ACCCTAGAAGTGCTGGTTTAAGG + Intronic
954798709 3:53174837-53174859 AGCCTGGCAGTGCAGGTTTAGGG + Intronic
956726262 3:72158850-72158872 CCCCATGCAGAGCAGGTTCCTGG + Intergenic
957022189 3:75139000-75139022 CCCCACACAGTGCAGGTCTGGGG - Intergenic
958010348 3:87870509-87870531 CACCAAGCTGTGCTGGTTTGTGG - Intergenic
958491143 3:94775479-94775501 GCCCAAGAAGTGTAGTTTTAAGG + Intergenic
958510072 3:95036951-95036973 CCCAAAGCAGTGCAGCATGAAGG - Intergenic
963519386 3:146345704-146345726 AGCCAAGCAGTGCAGGCCTATGG - Intergenic
963878886 3:150505155-150505177 CCCCTAGCAGCTCAGGTTCAGGG - Intergenic
965747159 3:171937598-171937620 ACACAAGCAGTGCTGGTTCAGGG - Intronic
974178986 4:58360551-58360573 CACCAAGGACTGCAGGTTGATGG - Intergenic
976123081 4:81804279-81804301 GCACAAGCAGTGCTGGTTTGAGG + Intronic
984040004 4:174720290-174720312 GTCCATGCAGTACAGGTTTATGG + Intronic
984045923 4:174798218-174798240 CCTGAAGCAGGGAAGGTTTAGGG + Intronic
989272372 5:39548392-39548414 GCCAAAGCAGTGCTGGTTTCTGG + Intergenic
991590947 5:68250817-68250839 CCTCAAGTAGTGCTGGTTTTAGG - Intronic
992550360 5:77853675-77853697 TCACAAGCAGAGCAGTTTTACGG - Intronic
993406765 5:87520329-87520351 CCTCTAGCACTGCTGGTTTAGGG + Intergenic
993441575 5:87963009-87963031 CACCAAGAAGTACAGTTTTAAGG - Intergenic
995708900 5:115014777-115014799 CCCCATGCAGTGCAGGACTAAGG + Intergenic
998415488 5:141943309-141943331 GCCCAAGGAGTACAGATTTAGGG + Intergenic
1000040885 5:157484447-157484469 CCCCAAGCTGTTGGGGTTTAAGG + Intronic
1006093346 6:31641146-31641168 CCCCAAGCAGTGCAGGTTTAGGG + Exonic
1006116764 6:31779787-31779809 CCCCATTCAGTACAGGTTTCAGG + Exonic
1015218666 6:130779531-130779553 CCCCAAGCAGTCCTTCTTTATGG - Intergenic
1021214675 7:17901260-17901282 CCCCAAGTAGTGCAGCTTGCAGG - Intronic
1022475104 7:30704897-30704919 CCCCAAGCAGGGGAGGGGTAGGG + Intronic
1025106680 7:56176255-56176277 CACCGAGCAGTGCAGGTTTGGGG + Intergenic
1029583477 7:101453954-101453976 ACCCCAGGAGTGCAGGTCTAAGG + Intronic
1030661273 7:112221823-112221845 CCCCAACCAGTACTGGTTTGTGG - Intronic
1034032810 7:147786510-147786532 TCCCCAGCAGTCCAGGTTTGTGG - Intronic
1039192610 8:34994182-34994204 CCCAAAGCAGTGCAGGTGATGGG - Intergenic
1041033596 8:53763930-53763952 CCCCAAGGAGTCCAGTCTTATGG + Intronic
1045793483 8:106014365-106014387 CCCCAACCCTTTCAGGTTTAAGG + Intergenic
1045963351 8:107995259-107995281 CCCCAACAATTGCAGATTTAGGG - Intronic
1048596419 8:135871698-135871720 CCCCAAGCAGTGTAACTTTGAGG - Intergenic
1048886675 8:138914709-138914731 CCCCCAGCAGAGCAGGGATATGG + Intergenic
1049284248 8:141766037-141766059 CCCCCAGCAGTGCAGGTAGCAGG - Intergenic
1050584006 9:7091065-7091087 CCCCAAGCAATGGAGGTTTTGGG - Intergenic
1051707923 9:19900014-19900036 CCTCAAGTAGTGAAGGTTCAGGG - Intergenic
1052829149 9:33200900-33200922 CCCCAATCAGTACTGGTTTCTGG - Intergenic
1055341639 9:75290698-75290720 CTCCAATCAGTTCAGGTTAAGGG - Intergenic
1056954026 9:91068187-91068209 TCCCATGCTGTACAGGTTTATGG + Intergenic
1062057078 9:134474338-134474360 GCCCAAGCCGTGCAGGCTTGCGG + Intergenic
1196259562 X:113562193-113562215 CCACAAGCACTGTGGGTTTATGG + Intergenic
1200755687 Y:6987946-6987968 TCCCAAGCAGTGCATGTGTTGGG + Intronic
1201255151 Y:12100112-12100134 CCCCAAGCACTGAAGATTAAGGG + Intergenic