ID: 1006093402

View in Genome Browser
Species Human (GRCh38)
Location 6:31641460-31641482
Sequence AATCATAAGACTGGGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 918
Summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 826}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006093395_1006093402 27 Left 1006093395 6:31641410-31641432 CCTGCACCAAGGACTGAGAGACA 0: 1
1: 0
2: 1
3: 24
4: 256
Right 1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG 0: 1
1: 1
2: 7
3: 83
4: 826
1006093396_1006093402 21 Left 1006093396 6:31641416-31641438 CCAAGGACTGAGAGACAAGATAA 0: 1
1: 0
2: 1
3: 20
4: 300
Right 1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG 0: 1
1: 1
2: 7
3: 83
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006093402 Original CRISPR AATCATAAGACTGGGAGTGG AGG Intronic
900224306 1:1525699-1525721 AATTAAAAGGCTGGGCGTGGTGG - Intronic
901093600 1:6660441-6660463 TATATTAAGACTGGGCGTGGTGG - Intronic
901520120 1:9777230-9777252 AAAAAAAAGCCTGGGAGTGGTGG + Intronic
901571423 1:10164012-10164034 AATAATAAGGCTGGGCATGGTGG - Intronic
901693126 1:10987011-10987033 AATCATGAGACCGGGCGCGGTGG + Intergenic
901869883 1:12132077-12132099 AAAAATGAGACTGGGCGTGGTGG - Intronic
902082670 1:13831841-13831863 ACCCATCAGACTGGGCGTGGTGG - Intergenic
902220270 1:14960152-14960174 AAGCATGAGACTGGGAGTCCAGG + Intronic
902444071 1:16450658-16450680 AATCTATAGGCTGGGAGTGGTGG + Intronic
902556533 1:17250166-17250188 AATCAGGATACTGGGAGGGGAGG + Intronic
902696043 1:18141573-18141595 AAGCATATGACTGAGAGTGAGGG + Intronic
903008914 1:20316899-20316921 AATCTTAATAGTGGGAATGGAGG + Intronic
903146181 1:21373607-21373629 AAACATAAGACTGGGCACGGTGG - Intergenic
903793237 1:25908762-25908784 AAGGATCAGACTGGGTGTGGTGG - Intergenic
904100874 1:28026044-28026066 AGTCATGAGGCTGGGCGTGGTGG - Intronic
904519361 1:31082638-31082660 AAAAATAAGGCTGGGCGTGGTGG + Intergenic
904902958 1:33871925-33871947 TATCACAAGAGTGGGACTGGTGG - Intronic
905128096 1:35730254-35730276 AAACCTAAGGCTGGGTGTGGTGG + Intronic
906338549 1:44956973-44956995 AAAAACAAGGCTGGGAGTGGTGG + Intronic
906342897 1:44996405-44996427 AATAATTAGGCTGGGTGTGGTGG - Intergenic
906439648 1:45830142-45830164 ATTCTTAAGGCCGGGAGTGGTGG - Intronic
907149155 1:52266382-52266404 AAGAATTAGACCGGGAGTGGTGG - Intronic
908762028 1:67521587-67521609 AAATACAAGGCTGGGAGTGGTGG - Intergenic
908878094 1:68700507-68700529 CACTATAAGATTGGGAGTGGTGG - Intergenic
909380813 1:74996419-74996441 AATAATAAGACTGTGGGTAGTGG - Intergenic
909814077 1:79968819-79968841 AATAATAAGACTGGGAGTGGTGG - Intergenic
910188080 1:84566915-84566937 AAAGATAAGGCTGGGTGTGGTGG - Intronic
910257690 1:85264762-85264784 ACTCATCAGGCTGGGTGTGGTGG + Intergenic
910675825 1:89815687-89815709 ATTCATAGGGCTGGGTGTGGTGG - Intronic
910782271 1:90952072-90952094 AATTCTAAGACTGGGAGTCAGGG - Intronic
910982391 1:92972108-92972130 AATGATCAGGCTGGGCGTGGTGG + Intergenic
911430767 1:97783677-97783699 AATAACAAGGCTGGGTGTGGTGG - Intronic
912349794 1:109001005-109001027 ATACATAAGACCGGGTGTGGTGG + Intronic
912645566 1:111388587-111388609 AACCACAAGGGTGGGAGTGGAGG + Intergenic
912785997 1:112604796-112604818 AAAAAAAAGACTGGGCGTGGTGG + Intronic
912803296 1:112735381-112735403 CATCATAAGGCTGGGCGCGGTGG + Intergenic
913064256 1:115235506-115235528 ATTCATAAGACCAGGCGTGGTGG - Intergenic
913105727 1:115612484-115612506 TATCATAGGAGTGGGACTGGCGG + Intergenic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
914357191 1:146897016-146897038 AATTAAAAGACAGGGAGTGAAGG + Intergenic
914861385 1:151389143-151389165 AATAATAAGGCTGGGCGTGGTGG - Intergenic
915152472 1:153845453-153845475 AAACATTAGGCTGGGCGTGGTGG + Intronic
915265613 1:154714824-154714846 GATGACCAGACTGGGAGTGGCGG - Intronic
915472317 1:156133283-156133305 AAGCATACGGCTGGGTGTGGTGG + Intronic
915505629 1:156354332-156354354 AAAAATAAGACTGAGAGAGGTGG + Intronic
916322139 1:163516730-163516752 AACAATATGTCTGGGAGTGGTGG + Intergenic
916542962 1:165774716-165774738 AACCATGAGGCTGGGTGTGGTGG - Intronic
916710344 1:167399954-167399976 AAAAAAAAGACTGGGAATGGTGG - Intronic
917085681 1:171303876-171303898 AATCATAAGGCTGGGTGCAGTGG + Intergenic
917940092 1:179910049-179910071 AAACATGAGGCTGGGTGTGGTGG - Intronic
918028920 1:180783765-180783787 AATGGTAAGGCTGGGCGTGGTGG + Intronic
918057538 1:181035011-181035033 AATCATATGGCTGGGAGTGGTGG + Intronic
918828240 1:189355197-189355219 AAAAAAAAGACTGGGAGAGGTGG + Intergenic
918833226 1:189425483-189425505 AATATTAAGACTGGGAATGGTGG - Intergenic
919862291 1:201748198-201748220 ATTCATAAGAGTGAGAGAGGAGG - Intronic
920001022 1:202798863-202798885 AATAATAATTCTGGGTGTGGTGG + Intronic
920236387 1:204509270-204509292 AATCAATAAACTGGGCGTGGTGG + Intergenic
920454574 1:206089328-206089350 GAACATAAGGCTGGGCGTGGTGG - Intronic
921141819 1:212314992-212315014 AATTATTAGGCTGGGCGTGGTGG - Intronic
921524479 1:216200734-216200756 AAAAATAAGATAGGGAGTGGAGG + Intronic
921860219 1:220035437-220035459 AATTAGCAGACTGGGCGTGGTGG - Intronic
922038358 1:221871702-221871724 AATTATTGGACTGGGTGTGGTGG - Intergenic
922787641 1:228290940-228290962 GATCATGAGGCTGGGTGTGGTGG + Intronic
923078174 1:230628908-230628930 AATCATTTTGCTGGGAGTGGGGG - Intergenic
923498926 1:234548577-234548599 AAACTTAAGGCTGGGCGTGGTGG - Intergenic
923688106 1:236168137-236168159 AATCTTAAGGCCGGGTGTGGTGG + Intronic
924227480 1:241933770-241933792 AAGAATGAGGCTGGGAGTGGTGG - Intergenic
924288113 1:242509087-242509109 AATAAATAGGCTGGGAGTGGTGG + Intronic
924439011 1:244071247-244071269 AATCACAAGAATTGGAGTGCAGG - Intergenic
924439155 1:244072272-244072294 AATCACAAGAATTGGAGTGCAGG - Intergenic
924513029 1:244743461-244743483 AATCATAGGGCTGGGTGCGGTGG - Intergenic
1063059685 10:2538298-2538320 AAACATTAGGCTGGGCGTGGTGG + Intergenic
1063116095 10:3073052-3073074 AAACACAGGACTGGGAGTTGGGG - Intronic
1063734116 10:8733113-8733135 TATAATAAGCCTGGGAATGGTGG + Intergenic
1064059524 10:12126329-12126351 AAAAATTAGACTGGGTGTGGTGG - Intergenic
1064065122 10:12175030-12175052 TATAATAAGGCTGGGCGTGGCGG + Intronic
1065675234 10:28166692-28166714 AAAGATAAGGCTGGGTGTGGTGG - Intronic
1066316655 10:34254092-34254114 AATTTTAAGGCCGGGAGTGGTGG + Intronic
1068108484 10:52650449-52650471 AATCCTAGGCCTGGGAGGGGTGG + Intergenic
1068674322 10:59754411-59754433 AATTATGTGGCTGGGAGTGGTGG + Intergenic
1068922596 10:62500298-62500320 AATCAGAAGACTGTGTGTTGTGG + Intronic
1068991189 10:63152707-63152729 ATTCATAAGACTGGGCATGGTGG + Intronic
1068995330 10:63195992-63196014 AATCAGCAGGCTGGGCGTGGTGG + Intronic
1069384719 10:67873990-67874012 AAACATAAGACCGGGCGCGGTGG + Intergenic
1069483074 10:68801557-68801579 AATAAAAAGACTGGGAGGGCAGG - Intergenic
1070178637 10:73994353-73994375 AATAATAAGGCCGGGCGTGGTGG - Intergenic
1070200925 10:74205386-74205408 AATTAGAAGACTGGGCGTGGTGG + Intronic
1070576688 10:77684467-77684489 CATCATAGGGCTGGGCGTGGTGG - Intergenic
1070776784 10:79114396-79114418 AATCTGGAGGCTGGGAGTGGGGG + Intronic
1070797997 10:79228381-79228403 AATCAAGAGACTGGGGGAGGAGG + Intronic
1070909125 10:80102189-80102211 AAAAATAAGGCTGGGAGCGGTGG + Intergenic
1071521839 10:86336383-86336405 AAACAGAAGGCTGGGAGTGGGGG + Intronic
1072705972 10:97681294-97681316 AATGATATGGCTGGGCGTGGTGG + Intronic
1072948975 10:99835887-99835909 AATGAGAAGACTGGGGTTGGTGG - Intronic
1073307013 10:102510831-102510853 AATAATTAGGCTGGGTGTGGTGG + Intronic
1073582184 10:104678826-104678848 GAACATAACACTGGGAGGGGAGG - Intronic
1074461125 10:113637634-113637656 CATCATTAGGCTGGGTGTGGTGG + Intronic
1074774993 10:116761196-116761218 AAACATTAGGCTGGGAGCGGTGG + Intergenic
1074887492 10:117705498-117705520 TATCATAGGAATGGGAGTCGTGG + Intergenic
1075384567 10:122046185-122046207 AATAATAGGGCTGGGTGTGGTGG + Intronic
1077821325 11:5744623-5744645 AAACAAAAGGCTGGGTGTGGTGG + Intronic
1078227283 11:9404012-9404034 AATGAAAAGGCTGGGAGTGGTGG - Intronic
1078247140 11:9584131-9584153 AAAAATAAGGCCGGGAGTGGTGG - Intronic
1078676111 11:13415941-13415963 GTTCATAAGGCTGGGTGTGGTGG - Intronic
1078814482 11:14806163-14806185 AATCATGTGGCTGGGCGTGGTGG + Intronic
1079049279 11:17139198-17139220 AATCATTAGGCCGGGCGTGGTGG - Intronic
1079118687 11:17660177-17660199 AATCAACAGGCTGGGTGTGGTGG + Intergenic
1079318704 11:19431908-19431930 ATTGATAAGACTGGGTGCGGTGG + Intronic
1079414701 11:20222917-20222939 AATCATATAAATGGGAATGGTGG - Intergenic
1079812328 11:25010557-25010579 AACAATAAGGCCGGGAGTGGTGG + Intronic
1080372390 11:31666294-31666316 AATCTGAAGGCTGGGTGTGGTGG - Intronic
1080466912 11:32506252-32506274 AATTTTCAGGCTGGGAGTGGTGG - Intergenic
1081978771 11:47253254-47253276 AGGTATAAGACTGGGTGTGGTGG - Intronic
1082031057 11:47603869-47603891 CTTCATGAGACTGGGTGTGGTGG - Intergenic
1082805894 11:57449986-57450008 ATTAATAAGCCTGGGGGTGGGGG + Intergenic
1083246909 11:61435833-61435855 AATGTTACGACTGGGTGTGGTGG + Intronic
1083398421 11:62407056-62407078 AATGATAAGGCTGGGAGCAGTGG + Intronic
1083436452 11:62646672-62646694 AATCATAAGGCCGGAAGGGGCGG - Intronic
1083461117 11:62812706-62812728 AATATTAAGTCTGGGCGTGGTGG - Intronic
1083557990 11:63647478-63647500 ACTTTTAAGACTGGGTGTGGTGG - Intronic
1083604012 11:63966502-63966524 ATTCCTTAGGCTGGGAGTGGTGG - Intergenic
1084026526 11:66453759-66453781 AATAAAGAGGCTGGGAGTGGTGG - Intronic
1084131882 11:67142361-67142383 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1084292922 11:68187283-68187305 AAAAAGAAGACTGGGCGTGGTGG - Intronic
1084377723 11:68789687-68789709 AATACAAAGCCTGGGAGTGGTGG - Intronic
1084842923 11:71872181-71872203 AATCTGAAGACTGGGAGTGTGGG - Intronic
1085006318 11:73093921-73093943 AAAGATAGGACTGGGTGTGGTGG + Intronic
1085321534 11:75577145-75577167 AATCAGAAGGCTGGGTGCGGTGG - Intergenic
1086363473 11:86083714-86083736 AATTGTGAGGCTGGGAGTGGTGG - Intergenic
1087742242 11:101901297-101901319 AATTAAAACACTGGGGGTGGGGG + Intronic
1087858535 11:103124155-103124177 AATAATGAGGCTGGGTGTGGTGG + Intronic
1088225964 11:107620578-107620600 AAACATGAGGCTGGGCGTGGTGG + Intronic
1088270658 11:108031078-108031100 AATCATGAGTCTGGGCCTGGTGG + Intronic
1088634262 11:111804436-111804458 AACAATAAGACTGGGTGTGGTGG + Intronic
1088664572 11:112081344-112081366 AATAATAAGGCTGGGCGCGGTGG + Intronic
1089309269 11:117547216-117547238 AAACATAAAAGTGGGGGTGGGGG - Intronic
1089872890 11:121692603-121692625 AATCATAGGAGTGGGGGTGGGGG - Intergenic
1089902547 11:122002629-122002651 AATTATCAGGCTGGGGGTGGAGG + Intergenic
1089904834 11:122027907-122027929 TATCATGAGAGTGGGACTGGTGG - Intergenic
1090754274 11:129775003-129775025 AAACAGAGGACTGGGTGTGGTGG - Intergenic
1090800011 11:130164704-130164726 AATAATAAGGCTGGGTGTGGGGG - Intronic
1091312856 11:134586815-134586837 AATTACAAGAGAGGGAGTGGAGG + Intergenic
1091808619 12:3376482-3376504 AATCAGGAGACTGAGAGTTGGGG + Intergenic
1092036288 12:5338047-5338069 AATTATAAGAATGTGAGCGGCGG + Intergenic
1092207272 12:6622459-6622481 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1092286162 12:7130306-7130328 AATCAGGTGACTGGGAGGGGGGG - Exonic
1092388227 12:8052153-8052175 TATCATATGGCTGGGCGTGGTGG - Intronic
1093094892 12:14960788-14960810 AATAATAGGGCTGGGCGTGGTGG - Intronic
1094123189 12:26995620-26995642 TATCATCACACTGGGAGTGAGGG - Intronic
1094599106 12:31892847-31892869 AAACATCAGGCTGGGTGTGGTGG + Intergenic
1094725932 12:33116204-33116226 AATCTTATGACTGGGGGTAGAGG + Intergenic
1095132424 12:38560125-38560147 TATCATAGGACTGGGACTGGTGG - Intergenic
1096066256 12:48743108-48743130 AAAAATAAGGCTGGGCGTGGTGG + Intergenic
1096129337 12:49145256-49145278 ACTCAGAAGGCTGGGCGTGGTGG - Intergenic
1096377120 12:51121751-51121773 AATCATTGGGCTGGGTGTGGTGG - Intronic
1096702938 12:53398566-53398588 AATAAAAAGACTGGGTTTGGTGG - Intronic
1097070075 12:56348372-56348394 AATAATAAGGCCGGGTGTGGTGG - Intronic
1097177462 12:57151644-57151666 ATTCATAAGACAGAGAGGGGTGG + Intronic
1097213900 12:57394920-57394942 AATTATAAGGCTGGGCGCGGTGG + Intronic
1097367134 12:58729394-58729416 TACCATCAGGCTGGGAGTGGTGG + Intronic
1097640452 12:62174473-62174495 TTTCATAAGCCTAGGAGTGGAGG + Intronic
1097909767 12:64957402-64957424 ATTCATAATGCTGGGTGTGGTGG - Intergenic
1097972539 12:65649935-65649957 AATGATAAGAACAGGAGTGGGGG + Intergenic
1098239967 12:68457029-68457051 AAGGAGAAGACTGGGGGTGGGGG - Intergenic
1098367984 12:69725694-69725716 AATAATTGGGCTGGGAGTGGTGG + Intergenic
1098652177 12:72986306-72986328 AACCATGAGGCTGGGCGTGGTGG - Intergenic
1099240628 12:80134514-80134536 AAACATAAAACTGTGAGTGGAGG - Intergenic
1099356742 12:81646395-81646417 CAGCATAAGACTGGGGCTGGAGG + Intronic
1099537132 12:83858236-83858258 AATCCTGCTACTGGGAGTGGTGG + Intergenic
1099663960 12:85602096-85602118 GATAATACAACTGGGAGTGGGGG - Intergenic
1100245200 12:92750736-92750758 GAAGATAAGGCTGGGAGTGGAGG - Intronic
1100256056 12:92884405-92884427 AATGACAACACTGGTAGTGGAGG + Intronic
1100485815 12:95025917-95025939 CATCTTAAGGCTGGGTGTGGTGG + Intronic
1100578323 12:95914034-95914056 AAACTTTAGGCTGGGAGTGGTGG + Intronic
1100635850 12:96433814-96433836 AATAATTACACTGGGAGTAGAGG + Intergenic
1101006910 12:100410206-100410228 AAAAATTAGACTGGGCGTGGTGG + Intronic
1101092429 12:101301378-101301400 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1101271133 12:103146191-103146213 AAACATAGGGCTGGGCGTGGTGG + Intergenic
1102032427 12:109749391-109749413 AAACACAAGGCTGGGCGTGGTGG - Intronic
1102121423 12:110444570-110444592 AATCACAAGGCTGGGTGCGGTGG - Intronic
1102187676 12:110962295-110962317 AATCATCAGGCTGGGCATGGTGG - Intergenic
1102296298 12:111739467-111739489 AAACATCAGGCTGGGCGTGGTGG + Intronic
1102335174 12:112072649-112072671 AAATATAAGGCTGGGTGTGGTGG + Intronic
1102380380 12:112460554-112460576 AATCTTAAGTCTGGGCGTGGTGG + Intronic
1102912701 12:116730185-116730207 AAAAATAAGGCTGGGCGTGGTGG - Intronic
1103281276 12:119759827-119759849 AATCATAAGAATTGGGGTGTGGG + Intronic
1103319656 12:120084423-120084445 AATCAGAAGACTTGAGGTGGAGG - Intronic
1103574309 12:121865700-121865722 AATCAAGAGGCTGGGTGTGGTGG + Intergenic
1103586125 12:121957415-121957437 AAACATAAGGCCGGGCGTGGTGG + Intronic
1104185332 12:126425229-126425251 CAGCATAAGACTGGCAGAGGTGG + Intergenic
1104705670 12:130945013-130945035 AATGACAAGTCTGGGAATGGGGG - Intergenic
1105212132 13:18263203-18263225 AAAAATTAGGCTGGGAGTGGTGG - Intergenic
1105254954 13:18738198-18738220 AATCATGGGACTGGGAGGGAGGG + Intergenic
1105869223 13:24489320-24489342 AATCATATGGCTGGGCGTGGTGG + Intronic
1106107716 13:26748419-26748441 AAACTTAAGGCTGGGTGTGGTGG + Intergenic
1106371870 13:29142414-29142436 GTTCATGAGACTGGGCGTGGTGG + Intronic
1106460932 13:29967411-29967433 AATTAAAAGACAGGGATTGGTGG + Intergenic
1107032398 13:35866694-35866716 CATCTTTAGACTGGGTGTGGTGG - Intronic
1107765133 13:43726502-43726524 AAACATGAGGCTGGGCGTGGTGG - Intronic
1108227941 13:48308364-48308386 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1108537199 13:51396082-51396104 AATAATAAGACCGGGCATGGTGG - Intronic
1108566235 13:51701233-51701255 AATAACAAGGCTGGGTGTGGTGG + Intronic
1109422078 13:62127190-62127212 AACAAAAAGGCTGGGAGTGGTGG + Intergenic
1109640073 13:65180137-65180159 AATCACAAGGCTGGGCATGGTGG - Intergenic
1109647884 13:65283818-65283840 AATCAGAAGAGTGGGGGGGGGGG + Intergenic
1110307069 13:74000509-74000531 AAACATAAAACTGGAAATGGGGG - Intronic
1110642975 13:77847917-77847939 AATCACCAGGCTGGGCGTGGTGG + Intergenic
1111197110 13:84889149-84889171 AACAAAAAGGCTGGGAGTGGGGG + Intergenic
1111553816 13:89852660-89852682 TATCATAGGAGTGGGAGTGGTGG - Intergenic
1111670243 13:91320861-91320883 AATTTTAAGGCTGGGTGTGGTGG + Intergenic
1112081328 13:95974792-95974814 AATAATGAGACTGGGTGCGGTGG + Intronic
1112124504 13:96449405-96449427 AATCATCAGACTGGTAGCAGAGG - Intronic
1112385087 13:98931883-98931905 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1112827715 13:103411299-103411321 AAACACAACTCTGGGAGTGGTGG - Intergenic
1113275626 13:108726271-108726293 ACTCGTAAGGCTGGGTGTGGTGG + Intronic
1114041235 14:18680618-18680640 AATAATAAGCCTGGGCATGGTGG - Intergenic
1114323138 14:21563705-21563727 ATTCAGAAGGCTGGGCGTGGTGG - Intergenic
1114478161 14:23012481-23012503 AATAATAAGGCCGGGTGTGGTGG + Intergenic
1115721414 14:36165174-36165196 AGTCAGAAGACTGGAAGTGGAGG + Intergenic
1115822514 14:37226645-37226667 AACCATATCACTGGGTGTGGTGG + Intronic
1115938252 14:38579166-38579188 TTTGATAAGACTGGGTGTGGTGG - Intergenic
1115949427 14:38703337-38703359 AAGCAAAAGACTGGGCATGGTGG + Intergenic
1116160231 14:41258480-41258502 AATTCTAATACTGGCAGTGGTGG - Intergenic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1116888301 14:50241766-50241788 AATAAAAAGGCTGGGAGTGGTGG + Intronic
1116889949 14:50258508-50258530 AAAAATAAGACTGGGCGTGGTGG - Intronic
1117190061 14:53280613-53280635 AAAAAAAAAACTGGGAGTGGTGG - Intergenic
1117248532 14:53911865-53911887 ATTGACAACACTGGGAGTGGGGG + Intergenic
1117388986 14:55244885-55244907 ATAAATAAGACTGGGTGTGGTGG - Intergenic
1117534951 14:56694797-56694819 AGACAGAAGCCTGGGAGTGGGGG - Intronic
1118082349 14:62375308-62375330 AATCATAAGGCTGGGTGCAGTGG + Intergenic
1118145539 14:63131104-63131126 AATTATAAGGCTGGGTGCGGTGG + Intergenic
1118203063 14:63695341-63695363 AAACAAAAGGCTGGGCGTGGTGG - Intronic
1118216501 14:63813634-63813656 AAAAATTAGACTGGGTGTGGTGG + Intergenic
1118342501 14:64906672-64906694 AATGAGAGGGCTGGGAGTGGTGG - Intergenic
1118845824 14:69547296-69547318 AAGCATAAGGCCGGGCGTGGTGG + Intergenic
1119032179 14:71201236-71201258 AAAAATTAGCCTGGGAGTGGTGG + Intergenic
1119230687 14:72977118-72977140 AATCATTAAACTGGGCGCGGTGG + Intronic
1119253751 14:73180270-73180292 AAGGATAAGGCTGGGCGTGGTGG - Intronic
1119255269 14:73190198-73190220 AATTTTAAGGCTGGGTGTGGTGG + Intronic
1119402717 14:74374945-74374967 AAACAAAAGGCTGGGCGTGGTGG + Intergenic
1119499518 14:75112239-75112261 AAACAAAAAACTGGTAGTGGAGG + Intronic
1119523049 14:75300439-75300461 AGTCATGAGACTGGGCGTGGTGG + Intergenic
1119536465 14:75406808-75406830 TATCATGAGAATGGGACTGGTGG - Intergenic
1119824096 14:77642549-77642571 AATGTTAAGGCTGGGAGCGGTGG + Intergenic
1119942515 14:78656490-78656512 AATTATAAGACTGGGAGCTTTGG + Intronic
1120322691 14:82985183-82985205 AATCATGTGGCTGGGCGTGGTGG - Intergenic
1120992215 14:90387306-90387328 AATCATAATAAGGGGAGTAGAGG + Intergenic
1121345374 14:93131810-93131832 AAAAAGCAGACTGGGAGTGGTGG - Intergenic
1121421438 14:93818555-93818577 CATCAGGAGACTGGGAGAGGAGG - Intergenic
1121647383 14:95528304-95528326 TATCAAAAGACTGGGTGTGGTGG - Intergenic
1202838862 14_GL000009v2_random:101752-101774 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1124227800 15:27910668-27910690 AAACATACGGCTGGGTGTGGTGG + Intronic
1124415399 15:29469485-29469507 AGTCATGCGGCTGGGAGTGGTGG - Intronic
1124475949 15:30034728-30034750 ATTAATTAGGCTGGGAGTGGTGG + Intergenic
1125324991 15:38527279-38527301 CAGCAAGAGACTGGGAGTGGAGG + Intronic
1125630183 15:41140937-41140959 AAGTATGAGGCTGGGAGTGGTGG - Intergenic
1125750387 15:42023778-42023800 AAACATACGAGTTGGAGTGGGGG - Intronic
1126528881 15:49689768-49689790 AATAAGAAGGCTGGGCGTGGTGG + Intergenic
1126534663 15:49748406-49748428 AATGACCAGACTGGGAATGGTGG - Intergenic
1126642733 15:50844080-50844102 ACTCATAGGGCTGGGTGTGGTGG + Intergenic
1126784991 15:52170816-52170838 ATTCATGAGGCTGGGCGTGGTGG + Intronic
1126859481 15:52870239-52870261 AATCATCTCACTGGAAGTGGAGG + Intergenic
1126893290 15:53230065-53230087 GAGCATGAGGCTGGGAGTGGTGG + Intergenic
1127828717 15:62730325-62730347 AAACATAAGGCTGGGTGCGGTGG - Intronic
1128714436 15:69897094-69897116 AATCAGAAGAATAGGATTGGAGG + Intergenic
1129343731 15:74903311-74903333 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1129874275 15:78962593-78962615 TTTCATAAGGCTGGGCGTGGTGG + Intronic
1130218254 15:81993868-81993890 AATCAAAAGACATAGAGTGGCGG + Intergenic
1131505963 15:93019644-93019666 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1131921077 15:97329296-97329318 ATACATAAGGCTGGGTGTGGTGG - Intergenic
1132427237 15:101728308-101728330 AATAACAAGGCTGGGTGTGGTGG + Intergenic
1133151842 16:3839391-3839413 ATTCATAAGGCTGGGTGAGGTGG + Intronic
1133243498 16:4430754-4430776 AGTCATCAGACTGGGGATGGTGG + Intronic
1133881209 16:9784140-9784162 AATTATATGGCTGGGTGTGGTGG + Intronic
1133951492 16:10398015-10398037 AAAGATAAGACTGGGCATGGTGG + Intronic
1134477408 16:14587619-14587641 AATTAGAAGGCTGGGTGTGGTGG - Intronic
1135416929 16:22275628-22275650 AATAAAAAGGCTGAGAGTGGTGG - Intronic
1135553468 16:23416314-23416336 AAACATCAGGCTGGGTGTGGTGG - Intronic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136241901 16:28949971-28949993 AATAATAAGGCTGGGCGTGGTGG - Intergenic
1136329570 16:29563098-29563120 AACCAGAAGGCTGGGCGTGGTGG + Intergenic
1136444199 16:30302805-30302827 AACCAGAAGGCTGGGCGTGGTGG + Intergenic
1137741733 16:50783218-50783240 AATGTTAAGGCTGGGCGTGGTGG - Intronic
1138242108 16:55435644-55435666 AAGCCTAAGACTGGGAGAGGAGG - Intronic
1138399202 16:56731696-56731718 AAACAGAAGACTGGGTGTGGTGG - Intronic
1138429235 16:56957730-56957752 AAACATCAGACCAGGAGTGGTGG + Intergenic
1139074496 16:63427587-63427609 TATCGTTAGACTGGGAATGGAGG - Intergenic
1139399909 16:66673196-66673218 AAAAAAAAGACTGGGTGTGGTGG - Intronic
1139751315 16:69110389-69110411 AATAATAAGGCCGGGTGTGGTGG - Intronic
1139816583 16:69679216-69679238 AAATATGAGGCTGGGAGTGGTGG - Intronic
1139858565 16:70001649-70001671 TATAATAAGGCTGGGCGTGGTGG + Intergenic
1139976979 16:70820118-70820140 AATTAAAAGACAGGGAGTGAAGG - Intronic
1140099157 16:71899586-71899608 AAACCTCAGGCTGGGAGTGGTGG + Intronic
1140429707 16:74891633-74891655 AACAAAAAGACTGGGTGTGGTGG + Intronic
1140698101 16:77554992-77555014 TATCATGAGGCTGGGAATGGTGG - Intergenic
1140988540 16:80185047-80185069 AAACATCAGGCTGGGTGTGGTGG + Intergenic
1141316667 16:82968830-82968852 AATAATAAGGCTGGGTGTAGTGG + Intronic
1141507242 16:84485967-84485989 AATAATAAGGCTGGGCGTGGTGG - Intronic
1141930597 16:87199963-87199985 CCTCATGAGACTGGGAGTTGAGG - Intronic
1141958276 16:87387009-87387031 AAAGAAAAGGCTGGGAGTGGTGG + Intronic
1142339689 16:89513245-89513267 AATTAAAAGGCTGGGCGTGGTGG + Intronic
1143643860 17:8216857-8216879 AATAATAAGGCCGGGCGTGGTGG - Intergenic
1143736369 17:8914501-8914523 AATCTTATGACAGGGATTGGCGG - Intronic
1144037131 17:11377253-11377275 AATTATTAGGCTGGGGGTGGTGG - Intronic
1144319079 17:14096142-14096164 TATCATAGGAGTGGGACTGGTGG - Intronic
1145080962 17:19893890-19893912 AAACACAAGGCTGGGCGTGGTGG - Intergenic
1145104952 17:20107321-20107343 CACCATCAGGCTGGGAGTGGTGG + Intronic
1145114842 17:20199551-20199573 AAACATTAGCCTGGGAATGGGGG - Intronic
1145794683 17:27648928-27648950 CATCAACAGACTGGAAGTGGGGG + Exonic
1145803457 17:27707563-27707585 AAAAATAAGTCTGGGTGTGGTGG + Intergenic
1146045237 17:29500024-29500046 AATGCTAAGGCTGGGAGTAGAGG + Intronic
1146335659 17:31967877-31967899 AAATATTAGACTGGGCGTGGTGG + Intronic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1146984415 17:37201149-37201171 CAACAGAAGGCTGGGAGTGGTGG + Intronic
1147300402 17:39521847-39521869 AAAAAAAAGGCTGGGAGTGGTGG - Intronic
1147330098 17:39693799-39693821 AATAATAGGGCTGGGTGTGGTGG + Intronic
1147380351 17:40051633-40051655 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1147478347 17:40735462-40735484 ATTGATAAGGCTGGGCGTGGTGG + Intergenic
1147943565 17:44067010-44067032 GATTATAAGGCTGGGAGCGGTGG + Intronic
1148227576 17:45909582-45909604 AATAATTAGGCTGGGTGTGGTGG + Intronic
1148436287 17:47688494-47688516 AAACATTAGGCTGGGCGTGGTGG + Intergenic
1148661775 17:49340017-49340039 AAACTCAAGGCTGGGAGTGGTGG - Intronic
1148689966 17:49521425-49521447 AAGCATGGGACTGAGAGTGGGGG + Intergenic
1148925414 17:51080593-51080615 CATCTTAAGGCTGGGTGTGGTGG + Intronic
1149539115 17:57455342-57455364 CATCATAAGACTTGAAATGGGGG + Intronic
1150585750 17:66516343-66516365 AAGAATAAGGCTGGGCGTGGTGG + Intronic
1150745459 17:67813186-67813208 AATATTTAGACTGGGCGTGGTGG - Intergenic
1151425023 17:74025355-74025377 AATCATCACACTGGGGGTTGGGG + Intergenic
1151582662 17:74988898-74988920 AATGACATCACTGGGAGTGGGGG + Intronic
1151592942 17:75058510-75058532 AATAATAAGGCTGGGTGCGGTGG + Intronic
1151734641 17:75931494-75931516 AACCATAGGGCTGGGTGTGGGGG + Intronic
1151764972 17:76128589-76128611 AAGCATAAGGCTGGGCATGGTGG + Intergenic
1151798484 17:76362917-76362939 AAAAATAAGGCTGGGCGTGGTGG + Intronic
1152081378 17:78189508-78189530 AAACAAAACACTGGGCGTGGTGG - Intronic
1152423078 17:80204469-80204491 AATCATGGGGCTGGGTGTGGTGG + Intronic
1154219255 18:12437673-12437695 AATCATACGGCTGGGCGTGGTGG - Intergenic
1154436074 18:14342408-14342430 AATCATGGGACTGGGAGGGAGGG - Intergenic
1155000452 18:21681013-21681035 AAACAACAGGCTGGGAGTGGTGG - Intronic
1155143129 18:23061329-23061351 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1155265691 18:24091092-24091114 GATCATAAGGCCGGGCGTGGCGG - Intronic
1155584723 18:27351876-27351898 AATCCTCAGACTGGGCATGGTGG + Intergenic
1155951998 18:31923857-31923879 AATAATAAGGCCGGGTGTGGTGG + Intronic
1156072900 18:33235285-33235307 AATAATCATACTGGGGGTGGGGG - Intronic
1156423658 18:36984614-36984636 AATAAAAAGACTGAGAGTGGTGG + Intronic
1157203379 18:45678104-45678126 AGTTACACGACTGGGAGTGGCGG - Intronic
1157249573 18:46082761-46082783 AATCAGTAGGCTGGGCGTGGTGG + Exonic
1158020967 18:52841117-52841139 AATGGTAAGACTTGGAGTGATGG + Intronic
1158142884 18:54275170-54275192 AATCATAAGGCTGGGTATTGTGG + Intronic
1158268444 18:55686058-55686080 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1158464761 18:57680295-57680317 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1158885519 18:61823584-61823606 AACCAAAAGGCTGGGCGTGGTGG - Intronic
1158987760 18:62836147-62836169 AATTAAAAGGCTGGGAATGGTGG + Intronic
1159113361 18:64085746-64085768 ACACATAAAACTGGGCGTGGTGG - Intergenic
1159642661 18:70881818-70881840 AATCAGTGGACTGGGAGAGGTGG + Intergenic
1159664867 18:71145707-71145729 AATCATCAGGCTGGGCGAGGTGG - Intergenic
1160259997 18:77284087-77284109 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1160337008 18:78051164-78051186 AATCATAAGACAGAAAGGGGTGG + Intergenic
1160467234 18:79089588-79089610 TTTCATAAGACTGGAAGTGAGGG - Intronic
1160879264 19:1312071-1312093 AGGCATAAGGCTGGGCGTGGTGG + Intergenic
1160936304 19:1597320-1597342 AATGAACAGGCTGGGAGTGGTGG - Exonic
1160954386 19:1683690-1683712 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1160999201 19:1901016-1901038 AAAAATAAGACTGGGAGTGGTGG - Intergenic
1161067479 19:2245839-2245861 AAGCAAAAGAGTGGAAGTGGAGG + Intronic
1161071237 19:2262417-2262439 AATTTTACGACTGGGCGTGGTGG + Intronic
1161097053 19:2398329-2398351 AAACATAAGTCTGGGCGTGGTGG + Intronic
1161246951 19:3258243-3258265 AATCACAGGGCTGGGCGTGGTGG - Intronic
1161640958 19:5422764-5422786 AATAATGAGCCTGGGTGTGGTGG - Intergenic
1161745320 19:6056003-6056025 AATCATAATAGTGGGTGGGGGGG + Intronic
1161900022 19:7111413-7111435 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1161914873 19:7220954-7220976 TATCATAGGAGTGGGACTGGTGG + Intronic
1161976195 19:7609032-7609054 AATTATAGGGCTGGGTGTGGTGG + Intronic
1162275104 19:9647365-9647387 AGTTATCAGGCTGGGAGTGGTGG - Intronic
1162352979 19:10162555-10162577 AAAAAGAAGACTGGGCGTGGTGG - Intronic
1162414831 19:10529316-10529338 AATAATAAGACCGGGAGTGGTGG + Intergenic
1162671308 19:12260024-12260046 AATGTAAAGAGTGGGAGTGGAGG - Intronic
1162671719 19:12263488-12263510 AAACAGAAGGCTGGGAGTGGTGG + Intronic
1162678153 19:12316121-12316143 AATCTGAAGGCTGGGTGTGGTGG + Intergenic
1163775981 19:19217989-19218011 AATAATAAGGCTGGGTGTAGTGG + Intronic
1163851367 19:19665829-19665851 AAACATTAGACTGGGAGCGCTGG - Intergenic
1163936251 19:20446996-20447018 AATTATAAGGCTGGGCATGGTGG - Intergenic
1164819594 19:31236859-31236881 AATCAACAGGCTGGGCGTGGTGG + Intergenic
1164903748 19:31949879-31949901 AAACATTAGGCTGGGTGTGGTGG + Intergenic
1165131277 19:33633952-33633974 AAACAAAAAGCTGGGAGTGGTGG - Intronic
1165173290 19:33908052-33908074 AAACAACAGGCTGGGAGTGGTGG - Intergenic
1165747533 19:38238923-38238945 AAATATAAGGCCGGGAGTGGTGG + Intergenic
1166117621 19:40665446-40665468 AAACAAAAGGCTGGGCGTGGTGG - Intergenic
1166698600 19:44868624-44868646 AATCTTGAGGCTGGGCGTGGTGG + Intronic
1166836864 19:45672590-45672612 AATGTTAAGGCTGGGCGTGGTGG - Intronic
1167815689 19:51878968-51878990 AATAATACGGCTGGGCGTGGTGG + Intronic
1167858178 19:52259852-52259874 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1168012375 19:53543552-53543574 CATAATAAGGCTGGGCGTGGTGG - Intronic
1168150239 19:54443028-54443050 TATCATAAGGCTGGGCGTGGTGG + Intergenic
1168222150 19:54968331-54968353 AAACACAACACTGGGGGTGGTGG - Intronic
1168449930 19:56458495-56458517 AATGAGAAGACTGTGACTGGGGG + Intronic
1168654068 19:58113980-58114002 AATAATAAGGCTGGGCGTGGTGG + Intronic
1202634166 1_KI270706v1_random:28815-28837 AAAAATGAGACCGGGAGTGGTGG + Intergenic
1202651710 1_KI270707v1_random:11188-11210 AAAAATGAGACCGGGAGTGGCGG - Intergenic
925516480 2:4689235-4689257 AATTATGAGAGTGGGACTGGTGG + Intergenic
926127552 2:10281020-10281042 AATGAAACGACTGGGTGTGGTGG - Intergenic
926769280 2:16353582-16353604 AATAATTAGGCTGGGTGTGGTGG - Intergenic
927412621 2:22844450-22844472 AACCACCAGAGTGGGAGTGGAGG + Intergenic
927585645 2:24301774-24301796 AATCATAACACTGGGAGCCAAGG - Intronic
927747565 2:25635143-25635165 AATGAAGAGGCTGGGAGTGGTGG + Intronic
927784417 2:25963478-25963500 AAAAATTAGGCTGGGAGTGGTGG - Intronic
928075421 2:28260181-28260203 ATTCAGAAGGCTGGGTGTGGTGG - Intronic
928093526 2:28390842-28390864 ACTCAGAAAACTGGGGGTGGGGG - Intergenic
928539368 2:32269878-32269900 ATTCATCTGGCTGGGAGTGGTGG + Intergenic
928569374 2:32588070-32588092 ATTAATAAGGCTGGGTGTGGTGG + Intronic
928789953 2:34938452-34938474 AATTATAGGGCTGGGTGTGGTGG - Intergenic
929343365 2:40850298-40850320 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
929883456 2:45857698-45857720 AATCAAAATGCTGGGTGTGGTGG - Intronic
929976228 2:46638192-46638214 AAACATTAGGCTGGGCGTGGTGG - Intergenic
930080291 2:47441088-47441110 AATAATAAGGCTGGGAGCAGTGG - Intronic
930082468 2:47463919-47463941 CATCATTGGACTGGGTGTGGTGG + Intronic
930197301 2:48522507-48522529 AAACAAGAGACTGGGTGTGGTGG + Intergenic
931020301 2:58037221-58037243 AATCAAGACACTGGGAATGGTGG - Intronic
931408908 2:62009315-62009337 AAGAATAAGACTGGGCATGGTGG + Intronic
931717726 2:65042490-65042512 AATAATAAGGCCGGGAGTGGTGG + Intergenic
932202252 2:69840453-69840475 ATTCATAACAGTGGCAGTGGAGG + Intronic
933332076 2:80905751-80905773 AATTATATGACTGGGCGCGGTGG + Intergenic
933654851 2:84879263-84879285 AACCTTGAGCCTGGGAGTGGAGG - Intronic
934077153 2:88438179-88438201 AATTAGATGACTGGGTGTGGTGG + Intergenic
934301494 2:91779200-91779222 AAAAATTAGGCTGGGAGTGGTGG + Intergenic
934483731 2:94680358-94680380 AATGATAAGGCTGGGCGTGGTGG - Intergenic
935029236 2:99306172-99306194 AATCATGAGGCAGGGTGTGGTGG - Intronic
935151071 2:100436521-100436543 TTTCATAAGGCTGGGTGTGGTGG + Intergenic
935254816 2:101300367-101300389 AATCTCAAGGCTGGGGGTGGGGG + Intronic
935768957 2:106398463-106398485 AAATATAAGGCTGGGCGTGGTGG - Intronic
935799377 2:106678328-106678350 TATCTTAAGGCTGGGTGTGGTGG + Intergenic
935911142 2:107897462-107897484 AAATATAAGGCTGGGCGTGGTGG + Intergenic
936132919 2:109862505-109862527 AAATATAAGGCTGGGCGTGGTGG + Intergenic
936211778 2:110508980-110509002 AAATATAAGGCTGGGCGTGGTGG - Intergenic
936420917 2:112363559-112363581 AAATATAAGGCTGGGCGTGGTGG - Intergenic
936554837 2:113486464-113486486 AATCTTTAGGCTGGGTGTGGTGG + Intronic
937152987 2:119698707-119698729 ACTCTTGAGACTGGGCGTGGTGG + Intergenic
937185850 2:120041485-120041507 AATAATAAAACTGGGAGGTGCGG - Intronic
937573681 2:123393318-123393340 AATAAAAAGGCTGGGCGTGGTGG + Intergenic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
938078256 2:128353591-128353613 TATCATGAGAGTGGGACTGGTGG + Intergenic
938268312 2:129945937-129945959 AATGATCATGCTGGGAGTGGTGG + Intergenic
938851718 2:135267355-135267377 TATCATAGGAGTGGGACTGGTGG - Intronic
938917344 2:135955944-135955966 AAACATATGGCTGGGCGTGGTGG - Intronic
939477550 2:142706252-142706274 AATATTTAGGCTGGGAGTGGCGG + Intergenic
939565835 2:143785433-143785455 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
940309189 2:152259059-152259081 AATAATCAGGCTGGGTGTGGTGG - Intergenic
940861258 2:158772634-158772656 AATCATGCTACTGGGAGAGGAGG + Intergenic
940917552 2:159273705-159273727 TTTCATAAGGCTGGGCGTGGTGG - Intronic
941363336 2:164580378-164580400 TATCATAAGGCTGGGCATGGTGG - Intronic
941387912 2:164875776-164875798 AATAATAAGGCTGGGTGCGGTGG - Intergenic
941440226 2:165525772-165525794 TAACATCAGGCTGGGAGTGGTGG - Intronic
941691436 2:168504121-168504143 AATCATCAGGGTGGGCGTGGTGG + Intronic
941937492 2:170996284-170996306 AATAATAAGGCTGGGCGTGGTGG - Intronic
943425686 2:187730805-187730827 AAACAAAAGGCCGGGAGTGGTGG + Intergenic
943452715 2:188065360-188065382 AATAAAAAGTCTGGGCGTGGTGG + Intergenic
943594960 2:189845143-189845165 AATTATGAGGCTGGGCGTGGTGG - Intronic
943684146 2:190799027-190799049 AATTATAAGGCTGGGTGTGGTGG - Intergenic
944245095 2:197522616-197522638 AATCATCAGACTGGGCATGGTGG - Intronic
944525216 2:200611990-200612012 AGAGATAAGTCTGGGAGTGGTGG - Intronic
944664209 2:201946077-201946099 ATTTATAAGGCTGGGCGTGGTGG - Intergenic
944691353 2:202161289-202161311 TATTATAAGACTGGGAGAGGAGG - Intronic
944762494 2:202831431-202831453 AATTATAAAGTTGGGAGTGGAGG - Intronic
945037016 2:205712767-205712789 AACCAGAAGACTGGAAGTTGGGG + Intronic
945657913 2:212647858-212647880 AATAATAAGACTAGGCATGGAGG - Intergenic
945795468 2:214357485-214357507 ACTCAGAAGACTGGGGGAGGGGG - Intronic
946121733 2:217521805-217521827 TATCATGAGAATGGGACTGGTGG - Intronic
946603180 2:221373660-221373682 AATAATTAGACTGGGCGCGGTGG + Intergenic
946719907 2:222593588-222593610 ACTCAAAAGACTAGGCGTGGTGG + Intronic
946740707 2:222798503-222798525 AAAAATAAGACTGGGTGCGGTGG - Intergenic
946845989 2:223859503-223859525 AAGAATGAGACTGGGCGTGGTGG - Intronic
947175109 2:227358433-227358455 AATCTCAAGGCTGGGTGTGGTGG + Intergenic
947205674 2:227658893-227658915 AATAAAAAGGCTGGGCGTGGTGG - Intergenic
947291267 2:228577490-228577512 AATCATCAGGCTGGGAGCGGTGG + Intergenic
948053996 2:234997833-234997855 AATCAGAAGACTGGGTGCGGTGG + Intronic
948243277 2:236456458-236456480 CATCACAAGACTGAAAGTGGTGG + Intronic
948552182 2:238780397-238780419 AATTATAGGGCTGGGCGTGGTGG - Intergenic
948841598 2:240653060-240653082 AATAATAAGCCTGGGCGCGGAGG + Intergenic
1169162919 20:3397603-3397625 AATCATAAGGCTGGGCGTGGTGG - Intronic
1169239252 20:3961112-3961134 AAGGATAAGGCTGGGTGTGGTGG + Intronic
1169467492 20:5854291-5854313 AAACATAAGGCCGGGTGTGGTGG - Intronic
1169641752 20:7760009-7760031 AATCATAAAAATGGTAGTGATGG - Intergenic
1169666124 20:8038203-8038225 ACTTATTAGACTGGGAGAGGAGG - Intergenic
1170217485 20:13906964-13906986 AATTATAAGGCCGGGTGTGGTGG - Intronic
1170638206 20:18128065-18128087 AAACAAAAGGCTGGGTGTGGTGG + Intergenic
1170853786 20:20029327-20029349 AGTAACAAGTCTGGGAGTGGTGG + Intronic
1171025249 20:21624237-21624259 AGACATAAGGCTGGGGGTGGTGG + Intergenic
1171982268 20:31636591-31636613 ACTTATAAAACTGGGCGTGGTGG - Intergenic
1172155199 20:32819515-32819537 AATTGTAAGCCTGGGAGCGGTGG + Intergenic
1172318362 20:33974691-33974713 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
1172542311 20:35728489-35728511 TAACTTTAGACTGGGAGTGGTGG + Intronic
1172578021 20:36024339-36024361 AATAATAAGGCTGAGCGTGGTGG + Intronic
1172738398 20:37146518-37146540 AATAATAAGGCTGGGCGTGGTGG + Intronic
1173618899 20:44421464-44421486 AATGAAAAGGCTGGGTGTGGTGG + Intronic
1173685120 20:44918036-44918058 AATCTTGTGACTGGGTGTGGTGG + Intronic
1173720934 20:45257416-45257438 TATCTCAAGGCTGGGAGTGGTGG + Intergenic
1173995753 20:47337377-47337399 AATCAAAGGGCCGGGAGTGGTGG + Intronic
1174225731 20:48998145-48998167 AAACATTAGACCGGGTGTGGTGG - Intronic
1174256593 20:49260791-49260813 AAAAAAAAGACTGGGCGTGGTGG + Intronic
1174509244 20:51038541-51038563 AAAAATAAGACTGGGTGCGGTGG + Intergenic
1174778559 20:53367856-53367878 AATAAGAAGGCTGGGCGTGGTGG - Intronic
1174786949 20:53441867-53441889 AATGAAAAGGCTGGGAGTGATGG - Intronic
1174815937 20:53686961-53686983 AATAATATGGCTGGGTGTGGTGG + Intergenic
1174817688 20:53700893-53700915 AATAATAGGGCTGGGCGTGGTGG - Intergenic
1175850797 20:62091351-62091373 TATCACAAGAATGGGACTGGCGG - Intergenic
1176600437 21:8788454-8788476 AAAAATGAGACCGGGAGTGGCGG + Intergenic
1176627583 21:9106494-9106516 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1176646384 21:9354595-9354617 AAAAATGAGACCGGGAGTGGTGG + Intergenic
1176840962 21:13843227-13843249 AATCATGGGACTGGGAGGGAGGG + Intergenic
1177091587 21:16775909-16775931 AATCATGAGGCAGGGAATGGGGG - Intergenic
1177587678 21:23119462-23119484 TATCACAAGAGTGGGACTGGTGG - Intergenic
1178015389 21:28339892-28339914 CAGGATAACACTGGGAGTGGAGG - Intergenic
1179252328 21:39682411-39682433 AATAATTAGACTAGGTGTGGTGG + Intergenic
1179450096 21:41462560-41462582 ATTCAAAAGGCTGGGCGTGGTGG - Intergenic
1180327898 22:11448098-11448120 AAAAATGAGACAGGGAGTGGTGG + Intergenic
1180366533 22:11944414-11944436 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1180417927 22:12786093-12786115 AAAAATGAGACTGGGAGTGGCGG - Intergenic
1180814944 22:18783523-18783545 AAAAATTAGGCTGGGAGTGGTGG - Intergenic
1181201132 22:21217859-21217881 AAAAATTAGGCTGGGAGTGGTGG - Intronic
1181693148 22:24577283-24577305 AAGAATAAGACTGGGGGTGGTGG + Intronic
1182460574 22:30480888-30480910 AACCAGAAGGCTGGGCGTGGTGG + Intergenic
1182509974 22:30812139-30812161 AATGAGAAGGCTGGGTGTGGTGG - Intronic
1182674311 22:32026089-32026111 ACTCACCAGACTGGGTGTGGTGG + Intergenic
1183388911 22:37532416-37532438 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1183811989 22:40265476-40265498 GATCGAAAGACTGGGAGTGTTGG + Exonic
1184081828 22:42226993-42227015 ATTTTTAAGACTGGGCGTGGTGG + Intronic
1203225783 22_KI270731v1_random:77572-77594 AAAAATTAGGCTGGGAGTGGTGG + Intergenic
1203265045 22_KI270734v1_random:9212-9234 AAAAATTAGGCTGGGAGTGGTGG - Intergenic
949546683 3:5079028-5079050 TAAAATAAGACTGGGCGTGGCGG + Intergenic
950342797 3:12262338-12262360 AATCATGAGGCAGGGCGTGGTGG + Intergenic
950485465 3:13271088-13271110 AATAATAGGGCTGGGCGTGGTGG + Intergenic
950787573 3:15449296-15449318 AATCATTTAATTGGGAGTGGTGG - Intronic
951771959 3:26268017-26268039 AACTATAAGACTGGGTGTGGTGG - Intergenic
952528001 3:34232940-34232962 AAAGCTTAGACTGGGAGTGGTGG - Intergenic
952599018 3:35056254-35056276 AAGAATAAGGCTGGGCGTGGTGG - Intergenic
952753444 3:36844512-36844534 GATCATATGGCTGGGCGTGGTGG - Intronic
953323843 3:41996041-41996063 AATAATAGGGCTGGGTGTGGTGG - Intergenic
953362871 3:42314457-42314479 AATGATAGGGCTGGGTGTGGTGG - Intergenic
954050379 3:47970520-47970542 CATCAGAAGGCTGGGCGTGGTGG + Intronic
954283050 3:49597928-49597950 AATAATGAGGCTGGGCGTGGTGG - Intronic
955005197 3:54962028-54962050 TATCATGAGAGTGGGACTGGTGG - Intronic
955086357 3:55706547-55706569 AATAAAATAACTGGGAGTGGTGG - Intronic
955171017 3:56565576-56565598 AATTATATGGCTGGGTGTGGTGG - Intronic
955284630 3:57627429-57627451 AAACATTAGGCTGGGTGTGGTGG - Exonic
955309244 3:57867971-57867993 AAACATAAGGCTGGGTGTGGTGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955693154 3:61609567-61609589 AGAAATAAGACTGGGTGTGGTGG + Intronic
956710997 3:72038798-72038820 AATCATTAGGCTGGGTGCGGTGG + Intergenic
956773345 3:72545503-72545525 TATCATCAGGCTGGGTGTGGTGG - Intergenic
957575942 3:82008359-82008381 AATTATCAGGCTGGGTGTGGTGG - Intergenic
957825031 3:85430525-85430547 AATAATAATATTGGAAGTGGAGG + Intronic
958511526 3:95055687-95055709 AAACATAGGATTTGGAGTGGTGG - Intergenic
958556063 3:95678700-95678722 AATAATATGGCCGGGAGTGGTGG + Intergenic
959532653 3:107451343-107451365 AGTCTTTGGACTGGGAGTGGAGG - Intergenic
959934794 3:112018118-112018140 AAGCATAAGGCTGGGCATGGTGG - Intergenic
960059116 3:113301332-113301354 AAACATAAAATTGGGAATGGTGG + Intronic
960500882 3:118437020-118437042 AATGATAACACGGGGAGGGGAGG - Intergenic
961142225 3:124565234-124565256 AATGATTAAATTGGGAGTGGAGG - Intronic
961770327 3:129244792-129244814 ATAAATAAGGCTGGGAGTGGTGG + Intergenic
961791021 3:129376916-129376938 ATACATTAGGCTGGGAGTGGTGG - Intergenic
962309946 3:134318631-134318653 AATAAAAAGACTGGGAATGCTGG + Intergenic
962578265 3:136774290-136774312 AATAAAAAGGCTGGGTGTGGTGG - Intergenic
963072158 3:141313150-141313172 AGGGATAAGGCTGGGAGTGGAGG - Intergenic
963232426 3:142921851-142921873 AATCATAAGGCTGGGCACGGTGG - Intergenic
963365277 3:144326099-144326121 AATAACAAGGCTGGGCGTGGTGG + Intergenic
964093881 3:152908839-152908861 AATAAGAAGGCTGGGCGTGGTGG - Intergenic
964629462 3:158794580-158794602 ATGAAGAAGACTGGGAGTGGGGG - Intronic
964788030 3:160421214-160421236 AATTATAGGGCTGGGTGTGGTGG - Intronic
964843187 3:161016692-161016714 AAACAAAAGATTGAGAGTGGAGG + Intronic
964951672 3:162302622-162302644 AAACATAAGGCTGGGAGCAGTGG - Intergenic
965007948 3:163049929-163049951 AATTAAAAGACCGGGTGTGGTGG - Intergenic
965577672 3:170234316-170234338 AAGTATAAGGCTGGGCGTGGTGG - Intronic
965578132 3:170238876-170238898 ATAAATAAGGCTGGGAGTGGTGG - Intronic
965611583 3:170549499-170549521 ATTCAAAAGGCTGGGCGTGGTGG - Intronic
965628706 3:170708409-170708431 AATAATAAGGCTGGGTGTGGTGG + Intronic
966187849 3:177244251-177244273 AAACAAAAGACTGGGCATGGTGG - Intergenic
966196212 3:177316539-177316561 AAAAATAAGTCTGGGTGTGGTGG + Intergenic
966268621 3:178077950-178077972 AATGAAAAGGCTGGGAGTGAAGG - Intergenic
967471332 3:189865281-189865303 AAATAAAGGACTGGGAGTGGAGG + Intronic
967480198 3:189963729-189963751 AATTGTAAGGCTGGGCGTGGTGG - Intronic
967489003 3:190067130-190067152 AAGAATAAGGCTGGGTGTGGTGG - Intronic
967819136 3:193825275-193825297 AATCAGGAGACTGGGCGTGTAGG - Intergenic
967837831 3:193979509-193979531 AATGATCAGGCTGGGCGTGGTGG + Intergenic
968246437 3:197154013-197154035 AAAAATAAGGCTGGGTGTGGTGG + Intronic
968315870 3:197724890-197724912 GATCAGTAGACTGGGTGTGGTGG + Intronic
1202740498 3_GL000221v1_random:50446-50468 AAAAATGAGACCGGGAGTGGTGG - Intergenic
969784014 4:9438235-9438257 AATCTGAAGACTGGGAGTGTGGG - Intergenic
970059312 4:12012781-12012803 AAAAATTAGCCTGGGAGTGGTGG - Intergenic
970097742 4:12484193-12484215 AATCAAAAGACGGAGAGTGGCGG - Intergenic
970395235 4:15658507-15658529 TATCATAGGAGTGGGACTGGTGG + Intronic
971019537 4:22519869-22519891 AAACAGAAGAATGGGCGTGGAGG + Intergenic
971350176 4:25848849-25848871 TATGATCAGACTGGGCGTGGTGG + Intronic
972045558 4:34661326-34661348 AATAATAAGGCTGGGTGTGGTGG - Intergenic
972315899 4:37925428-37925450 AATGATACGACTGGTTGTGGTGG + Intronic
972642569 4:40938957-40938979 TATCATGAGAGTGGGACTGGTGG + Intronic
973363865 4:49191200-49191222 AAAAATGAGACCGGGAGTGGCGG + Intergenic
973397215 4:49605538-49605560 AAAAATGAGACCGGGAGTGGCGG - Intergenic
973760867 4:54114237-54114259 AAACATAAAACTGGGCGTGGTGG - Intronic
973908709 4:55557123-55557145 TATCATCAGGCTGGGCGTGGTGG - Intronic
974009046 4:56590614-56590636 AACCATAAGGCTGGGTGTGGTGG - Intronic
974437047 4:61869629-61869651 AAAAATGAGACTGGGCGTGGTGG + Intronic
974529763 4:63092548-63092570 AACAATAAGGCTGGGCGTGGTGG + Intergenic
975137630 4:70889971-70889993 AAACAGATGACTGGGTGTGGTGG + Intergenic
975208218 4:71668550-71668572 AATCATAAGGCTGGGCACGGTGG - Intergenic
975560574 4:75704918-75704940 AAAATTAAGACTGGGTGTGGTGG - Intronic
975638335 4:76473318-76473340 AATGACAAGGCTGGGTGTGGTGG + Intronic
975858748 4:78653466-78653488 AATGCTAGGACTGGGAGTAGAGG + Intergenic
975909908 4:79255147-79255169 AATGATCACACTGGGGGTGGTGG + Intronic
976251471 4:83056217-83056239 AATCCTAAGGCCGGGCGTGGTGG - Intronic
976473998 4:85461767-85461789 AAACATAGGGCTGGGCGTGGTGG - Intergenic
976506696 4:85855417-85855439 AATCTGATGACTGGGTGTGGTGG + Intronic
976573566 4:86641232-86641254 ATGCATAACACTGGGAGTGGCGG + Intronic
977121382 4:93106026-93106048 AAACATAAGACTGGGGGAGGAGG - Intronic
977182789 4:93898315-93898337 AATCACAGGACTGGGCGTGGTGG - Intergenic
977431331 4:96933903-96933925 AATATTAAGGCTGGGCGTGGTGG + Intergenic
978147421 4:105392383-105392405 AAAAACAAGGCTGGGAGTGGTGG + Intronic
978268633 4:106859727-106859749 AATGATAAGACTTGTGGTGGAGG + Intergenic
978429301 4:108616994-108617016 AATCATCAGGCTGGGCGTGGTGG - Intergenic
978583299 4:110253530-110253552 AATAATTGGACTGGGTGTGGTGG - Intergenic
978760885 4:112355787-112355809 AAGCAGCAGACTGGAAGTGGGGG + Intronic
979221993 4:118237819-118237841 AATCTTTAGGCTGGGCGTGGTGG + Intronic
980500457 4:133645588-133645610 AATAATAAGACTGGGTGCAGTGG + Intergenic
980544209 4:134236842-134236864 AATTATATGGCTGGGCGTGGTGG - Intergenic
980919621 4:139070128-139070150 AATTACAAGGCTGGGTGTGGTGG - Intronic
981724586 4:147834180-147834202 ACTCATTAGGCTGGGAATGGTGG + Intronic
982223844 4:153147837-153147859 AACCATGAGACTGGGCGTGGTGG + Intergenic
982378755 4:154724981-154725003 AATAATAAAGCTGGGTGTGGTGG + Intronic
982429829 4:155310089-155310111 TATCACAAGATTGGGACTGGTGG + Intergenic
982698845 4:158635978-158636000 AATATTTAGACTGGGTGTGGTGG - Intronic
982916533 4:161217094-161217116 AATAATAAGGCCGGGTGTGGTGG + Intergenic
982998888 4:162387055-162387077 AATAATAAGGCCGGGCGTGGTGG - Intergenic
984134647 4:175920558-175920580 AATTATACGGCTGGGCGTGGTGG + Intronic
984369618 4:178846302-178846324 AATTATAGGGCTGGGCGTGGTGG + Intergenic
1202761178 4_GL000008v2_random:112296-112318 AAAAATGAGACCGGGAGTGGTGG + Intergenic
986353095 5:6898585-6898607 AAACACAAGGCTGGGTGTGGTGG + Intergenic
986556129 5:9011369-9011391 AATCATGAGGCCGGGCGTGGTGG + Intergenic
986687241 5:10285452-10285474 AATTTTAAGGCTGGGCGTGGTGG - Intronic
987319189 5:16751765-16751787 ACTCAGAAGGCTGGGAGCGGTGG - Intronic
987358586 5:17086425-17086447 AAAAATAAGGCTGGGCGTGGTGG + Intronic
987593219 5:19960970-19960992 TTTTATAAGACTGGGAGTGCAGG + Intronic
988443936 5:31263604-31263626 TATCATGAGAGTGGGAGTGGTGG - Intronic
988989320 5:36654127-36654149 AAACATTAGGCTGGGCGTGGTGG - Intronic
989055105 5:37359019-37359041 AAAAAAAAGACTGGGAGAGGTGG + Intronic
989192554 5:38685538-38685560 AACCACTAGGCTGGGAGTGGTGG - Intergenic
989384162 5:40837996-40838018 AATAATAAGGCTGGGTGCGGTGG + Intergenic
989569334 5:42930759-42930781 TATTAAAAGACTGGGTGTGGTGG - Intergenic
989577008 5:42997889-42997911 TATTAAAAGACTGGGTGTGGTGG - Intergenic
990322185 5:54640770-54640792 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
991299781 5:65119183-65119205 AATTAAAAGACTTGGAGAGGTGG + Intergenic
991381793 5:66035804-66035826 AGTAATCAGACTGGGCGTGGTGG + Intronic
991663858 5:68976990-68977012 AATCAAAAGACATAGAGTGGAGG + Intergenic
991701997 5:69325035-69325057 ACTCATTAGGCTGGGTGTGGTGG + Intronic
992273315 5:75088448-75088470 AATCATAAGAATGGAAATGATGG - Intronic
992591930 5:78304503-78304525 CATAAGAAGTCTGGGAGTGGTGG - Intergenic
992810155 5:80379094-80379116 TAAAAGAAGACTGGGAGTGGTGG + Intergenic
993204534 5:84863061-84863083 TATCAGAAGAATGAGAGTGGTGG + Intergenic
993462760 5:88204612-88204634 AATCATAACACTGGGGTTAGTGG + Intronic
993466782 5:88257180-88257202 AATCGCAAGACTGGGAGGGGAGG + Intronic
993730237 5:91413478-91413500 AAGAAAAAGGCTGGGAGTGGTGG + Intergenic
994579434 5:101620529-101620551 AATCATATGTCTGGCAGTTGAGG - Intergenic
994687432 5:102972567-102972589 AAACTTGAGGCTGGGAGTGGAGG - Intronic
994892734 5:105658748-105658770 AAACACAAGGCCGGGAGTGGTGG - Intergenic
995888656 5:116924186-116924208 TTTCAAAAGACTGGTAGTGGTGG + Intergenic
995921681 5:117322050-117322072 AATCATTAGAGTGGGACTAGTGG - Intergenic
996625533 5:125566289-125566311 CATCATGAGGCTGGGCGTGGTGG + Intergenic
996880037 5:128286660-128286682 ATTAATGAGGCTGGGAGTGGAGG + Intronic
997168991 5:131695432-131695454 AATATTGAGAGTGGGAGTGGGGG - Intronic
997174884 5:131764933-131764955 CATCATACGGCTGGGTGTGGTGG + Intronic
997249349 5:132376832-132376854 AAATCTAGGACTGGGAGTGGAGG - Intronic
997534696 5:134610177-134610199 AATAATAAGGCCGGGTGTGGTGG + Intronic
997976008 5:138441529-138441551 AAACAAAAGACTGGGCCTGGGGG + Intronic
998090025 5:139360250-139360272 AATAATTAGACTGGGTGCGGTGG - Intronic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
999299771 5:150484176-150484198 AAAAAAAAGGCTGGGAGTGGTGG - Intergenic
999421236 5:151446242-151446264 AAGCATAGGACTGGGTATGGTGG + Intronic
1000224904 5:159251237-159251259 AATAATACGGCTGGGCGTGGTGG + Intergenic
1000278610 5:159762633-159762655 AATCATAGGGCTGGGCATGGTGG + Intergenic
1000324121 5:160159181-160159203 AATCCAGAGGCTGGGAGTGGCGG - Intergenic
1000535772 5:162476738-162476760 AATAATAAGGCTGGGCGTGGTGG - Intergenic
1000863670 5:166486706-166486728 AAGAATAAAACTGGGTGTGGTGG - Intergenic
1001121266 5:168982285-168982307 TATCATAGGAGTGGGACTGGTGG + Intronic
1001647104 5:173290152-173290174 GATAATAAGGCTGGGTGTGGTGG - Intergenic
1001649717 5:173307260-173307282 ATTCCTAAGACTGGGATTGCTGG + Intergenic
1003394636 6:5742656-5742678 AAGCAGAAGAGTGGAAGTGGCGG - Intronic
1003628608 6:7766323-7766345 AATCACTAGGCTGGGTGTGGTGG + Intronic
1004196145 6:13507040-13507062 AGAAATAAGACTGGGCGTGGTGG + Intergenic
1004247770 6:13996553-13996575 TATCATAGGAGTGGGACTGGTGG - Intergenic
1004848723 6:19674298-19674320 AATCTTAAGGCTGGGCATGGTGG + Intergenic
1004896264 6:20150867-20150889 AATGAAAAGGCTGGGCGTGGTGG - Intronic
1005526532 6:26656959-26656981 GATCATAAGGCCGGGCGTGGTGG + Intronic
1005727567 6:28664692-28664714 AAAAATTAGACTGGGTGTGGTGG - Intergenic
1005927859 6:30459289-30459311 AATCAAAAGAAATGGAGTGGTGG + Intergenic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1006201362 6:32295040-32295062 AATCAGAAGACTTGGGCTGGGGG + Intronic
1006546038 6:34782398-34782420 AATCATTAGGCTGGGCGTGGTGG + Intergenic
1006615863 6:35326364-35326386 AAAAATTAGACTGGGCGTGGTGG + Intergenic
1006760132 6:36453297-36453319 AAACAAAAGGCTGGGGGTGGTGG - Intronic
1007337621 6:41165028-41165050 AATCCTAAGAATGGGACTGCTGG + Intergenic
1007887148 6:45242905-45242927 TATTATAAGGCTGGGCGTGGTGG + Intronic
1009280772 6:61748274-61748296 AATATTAAGTCTGGGTGTGGTGG - Intronic
1009816292 6:68740269-68740291 AGTGATAAGTCTGGGCGTGGTGG + Intronic
1009951457 6:70401718-70401740 TATATTAAGACTGGGAGTGGTGG + Intergenic
1010302309 6:74275381-74275403 TATCATAGGAGTGGGACTGGTGG + Intergenic
1010387225 6:75294990-75295012 AAAAATAAGACTGGGCATGGTGG - Intronic
1010469828 6:76214204-76214226 AATCTTAGGACTGGGCGTGGTGG + Intergenic
1011249932 6:85360391-85360413 AATTATAAGGCCGGGTGTGGTGG + Intergenic
1011969797 6:93208881-93208903 ATTCATAAGGCTGGCAGTGTGGG - Intergenic
1012477107 6:99625826-99625848 AATCCTGAGGCTGGGTGTGGTGG + Intergenic
1012582391 6:100884354-100884376 TATCATATGGCTGGGTGTGGTGG + Intergenic
1012724440 6:102791506-102791528 ATTCAAAAGGCTGGGGGTGGTGG + Intergenic
1012932247 6:105329439-105329461 AATTATAAGGCTGGGCGTGGTGG - Intronic
1012937722 6:105385832-105385854 AATTGTCAGACTGGGTGTGGTGG + Intronic
1013260149 6:108433572-108433594 AATAATAAGGCTGGGCGTGGTGG - Intronic
1013351354 6:109308823-109308845 AACCATATGGCTGGGTGTGGTGG + Intergenic
1013670722 6:112399642-112399664 AATCACCTGACTGGGTGTGGGGG - Intergenic
1013860281 6:114627318-114627340 AATCAGAACTCTGTGAGTGGGGG - Intergenic
1014440099 6:121463897-121463919 AAAAAAAAGACTGGGCGTGGTGG - Intergenic
1015001049 6:128216247-128216269 AAAAATAAGGCCGGGAGTGGTGG + Intronic
1016838869 6:148506184-148506206 AATAATAAGGCTGGGCTTGGTGG + Intronic
1016947544 6:149548300-149548322 AATCCTAAGACTGTGAGTTCTGG + Intergenic
1017130492 6:151104369-151104391 ATTAATGAGGCTGGGAGTGGTGG - Intergenic
1017249625 6:152264920-152264942 AATCTTAGGGCTGGGCGTGGTGG + Intronic
1017796679 6:157850966-157850988 AGTGATAAGGCTGGGCGTGGTGG + Intronic
1018492165 6:164305084-164305106 AATCATAAGGCCGGGTGTGGTGG + Intergenic
1019546005 7:1576566-1576588 AAAGATAAGGCTGGGCGTGGTGG + Intergenic
1019700486 7:2472519-2472541 AAAAAAAAGACTGGGCGTGGTGG + Intergenic
1019979182 7:4608594-4608616 AATGATTAGGCTGGGCGTGGTGG - Intergenic
1020403480 7:7804383-7804405 AAAAATGAGACTGGGCGTGGTGG + Intronic
1020420562 7:7999615-7999637 AAGAACAAGGCTGGGAGTGGTGG + Intronic
1020446825 7:8277385-8277407 AATATTAGGACTGGGAGAGGTGG - Intergenic
1021627828 7:22611977-22611999 GATGAGAAGGCTGGGAGTGGGGG - Intronic
1021636545 7:22699624-22699646 AACCGTCAGACTGGGTGTGGTGG - Intergenic
1021888264 7:25161981-25162003 AATTATAAGGCTGGGAGTGGTGG + Intronic
1022140023 7:27485601-27485623 AAAAATTAGGCTGGGAGTGGTGG - Intergenic
1022301139 7:29103538-29103560 AATCATGAGGCTGGGTGTGGTGG - Intronic
1022328841 7:29358749-29358771 AATCATTAGGCTGGGCGCGGTGG - Intronic
1022808478 7:33846516-33846538 AAGCAAAAGACTTGGAGTTGGGG - Intergenic
1023415901 7:39932168-39932190 AATAATGAGACTGGGTGTGGTGG + Intergenic
1023448598 7:40257586-40257608 AAATTTAAGACTGGGTGTGGTGG + Intronic
1023846691 7:44124803-44124825 AAATATAAGGCTGGGCGTGGTGG - Intergenic
1023856900 7:44189547-44189569 ATGCATAAAACTGGGACTGGTGG + Intronic
1023883193 7:44333258-44333280 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1024275010 7:47670413-47670435 AAAAACAAGACTGGGTGTGGTGG + Intergenic
1024541386 7:50477684-50477706 ACTCATAAAACAGGGGGTGGAGG - Intronic
1024945712 7:54805704-54805726 AATCAGAAGCCCGGGTGTGGTGG + Intergenic
1025062080 7:55818801-55818823 AATCATGACACTGAGAGTGCTGG - Intronic
1025225133 7:57151603-57151625 AATCAAGAGGCTGGGAGTCGTGG - Intergenic
1025232605 7:57212593-57212615 ACTCATCAGGCTGGGCGTGGTGG - Intergenic
1025941677 7:66079903-66079925 TTTTATAGGACTGGGAGTGGTGG - Intronic
1025958834 7:66203390-66203412 AATCAGCTGACTGGGTGTGGTGG - Intergenic
1026161745 7:67875508-67875530 AATTATAAGCCTGGGCATGGTGG - Intergenic
1026165641 7:67906741-67906763 AGTCAAAAGACTGAGAGAGGTGG + Intergenic
1026963187 7:74422901-74422923 AATTATAAGGCCGGGCGTGGTGG - Intergenic
1027510641 7:79075471-79075493 TATCATTAGGCTGGGAGTGGTGG + Intronic
1027759685 7:82262042-82262064 AAACACAAGGCTGGGTGTGGTGG + Intronic
1027768631 7:82378108-82378130 AATATTAAGGCTGGGTGTGGTGG + Intronic
1028764578 7:94538352-94538374 AATCAGAATACTGTGAGTAGTGG - Intronic
1028862547 7:95669753-95669775 AATCAAACAACTGGGAGTTGTGG + Intergenic
1029135219 7:98365765-98365787 AATCAAAAGGCTGGGCGTGGTGG - Intronic
1029220969 7:98989938-98989960 AATCAAAAGGCCGGGAGTGGTGG + Intronic
1029411275 7:100412866-100412888 AAAAATAAGGCTGGGCGTGGTGG - Intronic
1029463378 7:100709578-100709600 AAAAATAAGGCTGGGTGTGGTGG + Intergenic
1029621644 7:101693608-101693630 ACTCAGAAGACTGGGATGGGAGG + Intergenic
1029689694 7:102173070-102173092 AAATATGAGACTGGGTGTGGTGG + Intronic
1029789255 7:102825312-102825334 TATCATGAGAGTGGGACTGGTGG + Intronic
1030090441 7:105853399-105853421 AACCATTAGGCTGGGCGTGGTGG + Intronic
1030244098 7:107361845-107361867 AATCATGGGGCTGGGCGTGGTGG - Intronic
1030887757 7:114959844-114959866 AATAATAATAATGGGACTGGAGG + Intronic
1030937760 7:115606720-115606742 AATAACAATACTGGGAGTGTGGG + Intergenic
1031074671 7:117200723-117200745 AATTATAAGTCTGGGAGTGCGGG + Intronic
1032633982 7:133686068-133686090 TATCATGAGATTGGGACTGGTGG + Intronic
1033095088 7:138423726-138423748 AATAATAAGACCAGGTGTGGTGG - Intergenic
1033281338 7:140008734-140008756 AAAAATAAGGCTGGGATTGGTGG - Intronic
1033375486 7:140757573-140757595 AATCCTAAGGCTGGGCGTGGTGG - Intronic
1033586852 7:142780560-142780582 AGGCATGAGACTGGGAGTGGGGG - Intergenic
1033613658 7:142989978-142990000 AAACATCAGGCTGGGCGTGGTGG - Intergenic
1033999853 7:147399816-147399838 AATCATAGAACTGGAAGGGGAGG + Intronic
1034510153 7:151527492-151527514 TATTAAAAGACCGGGAGTGGTGG - Intergenic
1034625431 7:152488530-152488552 AATCAACAGGCTGGGTGTGGTGG + Intergenic
1034713175 7:153215007-153215029 AAAAATAAGACTGGGTGCGGTGG - Intergenic
1034823318 7:154237074-154237096 AATCTTACGACTGGGCGTGAGGG + Intronic
1035181681 7:157093844-157093866 AACCAAAAAACTGGGCGTGGTGG + Intergenic
1036835027 8:12055893-12055915 AATCTGAAGACTGGGAGTGTGGG + Intergenic
1036856870 8:12302457-12302479 AATCTGAAGACTGGGAGTGTGGG + Intergenic
1036985321 8:13522335-13522357 AAACATAAGTCTGGGAGCGGTGG + Intergenic
1037331705 8:17749369-17749391 AATCTTTAGGCTGGGGGTGGTGG + Intronic
1038177001 8:25189646-25189668 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1038284214 8:26192303-26192325 AATCACAGGGCTGGGCGTGGTGG - Intergenic
1038727413 8:30094207-30094229 AATTATAGGACTGGGGATGGAGG + Intergenic
1038735161 8:30162032-30162054 AATATTAAGGCTGGGCGTGGTGG - Intronic
1038774349 8:30514811-30514833 ATTAATATGGCTGGGAGTGGTGG - Intronic
1039094994 8:33873998-33874020 AATCATCAGGCTGGGCGCGGTGG - Intergenic
1039273287 8:35906758-35906780 AATCATATGCCTGGGTGTGGTGG - Intergenic
1039304993 8:36251833-36251855 AAAAAAAAAACTGGGAGTGGTGG - Intergenic
1039495821 8:37979300-37979322 CATCATTAGGCTGGGAATGGTGG + Intergenic
1039500916 8:38016512-38016534 ATTAATTAGGCTGGGAGTGGTGG + Intergenic
1039503611 8:38035503-38035525 AATAATAAGGCCGGGTGTGGTGG - Intronic
1039663892 8:39498514-39498536 TATCATAAGAATGAGACTGGTGG + Intergenic
1039820002 8:41126690-41126712 AATCAGGAAAGTGGGAGTGGGGG - Intergenic
1040029589 8:42812675-42812697 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
1040046964 8:42974524-42974546 AATCATCTGGCTGGGCGTGGTGG - Intronic
1041065627 8:54080096-54080118 AATCTTCAGGCTGGGCGTGGTGG + Intronic
1041070394 8:54122837-54122859 AATGATCAGGCTGGGTGTGGTGG + Intergenic
1041763002 8:61387098-61387120 ACTAGTAAGACTGGGCGTGGTGG + Intronic
1042220603 8:66469568-66469590 AAAAATGAGGCTGGGAGTGGTGG - Intronic
1042343798 8:67707619-67707641 AAACTTAAGGCTGGGTGTGGTGG + Intronic
1042357736 8:67847526-67847548 AATTATAGGGCTGGGCGTGGTGG - Intergenic
1042553081 8:70011616-70011638 AAGAATAAGGCTGGGTGTGGTGG - Intergenic
1042856857 8:73276463-73276485 CATCAGAAGGCTGGGTGTGGTGG - Intergenic
1042932595 8:74028222-74028244 AATACTAAGGCTGGGTGTGGTGG - Intronic
1043059046 8:75476901-75476923 AATGTTAACACTGGGAGGGGAGG - Intronic
1043113458 8:76217350-76217372 AATAATAAGGCCGGGCGTGGTGG - Intergenic
1043577064 8:81669906-81669928 CATCATAGGACTAGGACTGGTGG + Intronic
1045454770 8:102367028-102367050 AAGCCTAAGTCTTGGAGTGGTGG + Intronic
1045828025 8:106424223-106424245 AAGAATCAGACTGGGTGTGGTGG - Intronic
1046030083 8:108773443-108773465 AATCAAAATACTGAGAGTGAAGG + Intronic
1046049651 8:109008165-109008187 AAGCAAAAGACTGGGTGAGGTGG + Intergenic
1046584090 8:116130013-116130035 AATCAGAAGTTTGGGAGTTGAGG + Intergenic
1046951429 8:120023434-120023456 AATAATTAGGCTGGGCGTGGTGG - Intronic
1046967969 8:120188367-120188389 AATGTTAAGTCTGGGTGTGGTGG - Intronic
1047088194 8:121543162-121543184 AATGAAAAGGCTGAGAGTGGTGG - Intergenic
1047636698 8:126771286-126771308 AATCATATGGCTGGGCGTGGTGG - Intergenic
1048008285 8:130436820-130436842 AAAAATTAGGCTGGGAGTGGTGG + Intronic
1048171346 8:132109663-132109685 AATCATGTGACTGGGAGCTGGGG - Intronic
1048238172 8:132713130-132713152 AATGACAAGGCTGGGTGTGGTGG - Intronic
1048803014 8:138211778-138211800 AATTATAAGTCTGGGCATGGTGG + Intronic
1048866114 8:138763097-138763119 AAACAAAAGCCTGGGCGTGGTGG + Intronic
1049278317 8:141731081-141731103 AATCACAGGGCTGAGAGTGGGGG - Intergenic
1049341852 8:142117289-142117311 AAGCCTCAGAATGGGAGTGGTGG + Intergenic
1049811252 8:144573883-144573905 CATAATTAGGCTGGGAGTGGTGG + Intronic
1049898174 9:130719-130741 AATCTTTAGGCTGGGTGTGGTGG - Intronic
1050518993 9:6477235-6477257 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1051072444 9:13188228-13188250 AATGTTAAGGCTGGGCGTGGTGG + Intronic
1051106485 9:13586841-13586863 AATCACAAGACGGGAAGAGGAGG + Intergenic
1051274325 9:15384379-15384401 AATGATGAGGCCGGGAGTGGTGG + Intergenic
1051424715 9:16921445-16921467 AATCAAGAGGCTGGGCGTGGTGG + Intergenic
1051737969 9:20222033-20222055 AAACAAAAAGCTGGGAGTGGGGG + Intergenic
1052130927 9:24845924-24845946 AATATTAAGGCTGGGCGTGGTGG + Intergenic
1052198137 9:25743458-25743480 AATTATTAGACTGGGGGCGGGGG + Intergenic
1052910453 9:33876626-33876648 AATCATAAGGCCGGGGGCGGTGG + Intronic
1053128554 9:35602227-35602249 AAACATATGGCTGGGTGTGGTGG + Intergenic
1053178445 9:35946668-35946690 AATCTCAAGGCTGGGTGTGGTGG - Intergenic
1053190484 9:36062446-36062468 CAACAAAAGACTGGGTGTGGTGG - Intronic
1053565278 9:39242833-39242855 AAGCATAAAGTTGGGAGTGGGGG + Intronic
1053674054 9:40404034-40404056 AATGATGAGGCTGGGCGTGGTGG + Intergenic
1053741241 9:41141013-41141035 AATCTTTAGGCTGGGTGTGGTGG - Intronic
1053741880 9:41148920-41148942 ATTTATAAGGCTGGGTGTGGTGG + Intronic
1053923857 9:43030401-43030423 AATGATGAGGCTGGGCGTGGTGG + Intergenic
1054131873 9:61376206-61376228 AAGCATAAAGTTGGGAGTGGGGG - Intergenic
1054346450 9:63970503-63970525 AATCTTTAGGCTGGGTGTGGTGG - Intergenic
1054347142 9:63978721-63978743 ATATATAAGACTGGGTGTGGTGG + Intergenic
1054385158 9:64544103-64544125 AATGATGAGGCTGGGCGTGGTGG + Intergenic
1054486046 9:65724353-65724375 AATCTTTAGGCTGGGTGTGGTGG + Intronic
1054510571 9:65972256-65972278 AATGATGAGGCTGGGCGTGGTGG - Intergenic
1054686463 9:68282380-68282402 ATTTATAAGGCTGGGTGTGGTGG - Intronic
1054687108 9:68290279-68290301 AATCTTTAGGCTGGGTGTGGTGG + Intronic
1055724245 9:79210658-79210680 ATTCATAGGACTGGGCATGGTGG - Intergenic
1055756013 9:79557784-79557806 AGGCATGAGGCTGGGAGTGGTGG - Intergenic
1055960614 9:81817166-81817188 AAACGTAAGGCCGGGAGTGGTGG + Intergenic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056360550 9:85853496-85853518 AATAATCAGGCTGGGCGTGGTGG + Intergenic
1056388896 9:86122329-86122351 AATCATAAGAAGGGTAGAGGTGG + Intergenic
1056426506 9:86482735-86482757 AAGCAGAAGCCTGGGTGTGGTGG + Intergenic
1057043623 9:91866403-91866425 AAAAAAAAGACTGGGCGTGGTGG - Intronic
1058033282 9:100223382-100223404 ATTTACAAGCCTGGGAGTGGTGG - Intronic
1058857066 9:109072716-109072738 AATTATAAAACTGGGCATGGTGG + Intronic
1058886210 9:109323038-109323060 AATAATATGGCTGGGTGTGGTGG + Intergenic
1059566597 9:115388555-115388577 TATAATAAGGCTGGGTGTGGTGG + Intronic
1060056846 9:120421348-120421370 TATTATAAGAATGGAAGTGGAGG + Intronic
1060337498 9:122739507-122739529 TATCACAAGAGTGGGACTGGTGG - Intergenic
1060606580 9:124920110-124920132 AAAAATAAGGCTGGGTGTGGTGG - Intronic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1060703212 9:125777649-125777671 AATAATTAGGCTGGGCGTGGTGG - Intronic
1060857725 9:126928201-126928223 AATCCTAAGACCTGGAGTGTAGG + Intronic
1061012996 9:127966362-127966384 ACTCAAGAGACTGGGACTGGAGG + Intronic
1061323949 9:129850939-129850961 AAACAAAAGACTGGGTGCGGTGG - Intronic
1061376800 9:130230802-130230824 AATCACAAGAGTGGGGGTGGGGG - Intronic
1061464908 9:130770217-130770239 ATTTATAAGACTGGGTATGGTGG + Intronic
1061642213 9:131968105-131968127 AATCATGAGGCCGGGGGTGGTGG - Intronic
1062335653 9:136065330-136065352 AATAATTAGGCTGGGCGTGGTGG + Intronic
1203750429 Un_GL000218v1:74174-74196 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1203709142 Un_KI270742v1:80395-80417 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1203541947 Un_KI270743v1:97177-97199 AAAAATGAGACCGGGAGTGGTGG + Intergenic
1185592229 X:1285186-1285208 CATCTGAAGACTGGGGGTGGTGG - Intronic
1186299340 X:8182743-8182765 AAAGATAAGGCTGGGTGTGGTGG + Intergenic
1186792368 X:13011575-13011597 ACTCATAAGTCTGGGATTGCTGG - Intergenic
1188073016 X:25740508-25740530 AAATAAAAGACTGGGTGTGGCGG - Intergenic
1188080088 X:25828345-25828367 AAATATAAGGCTGGGTGTGGTGG - Intergenic
1188347769 X:29088386-29088408 AATAATAAGGCCGGGCGTGGTGG + Intronic
1188610243 X:32087071-32087093 AGTCATTAGAAAGGGAGTGGTGG - Intronic
1188801441 X:34536081-34536103 TATCACAAGAATGGGACTGGTGG + Intergenic
1189400962 X:40668093-40668115 AATACTAAGGCTGGGTGTGGTGG + Intronic
1189554907 X:42132287-42132309 AAGTATAAGATTGGGAGTAGCGG + Intergenic
1189955298 X:46271467-46271489 AAACTTGGGACTGGGAGTGGAGG - Intergenic
1190043725 X:47094582-47094604 AATAATAAGGTTGGGTGTGGTGG - Intergenic
1190919322 X:54836822-54836844 AATCAAAAGACAAAGAGTGGTGG - Intergenic
1191732956 X:64357181-64357203 AAACATAAGACAGGGATAGGAGG - Intronic
1192003526 X:67183199-67183221 AATCTTTAGGCTGGGTGTGGTGG - Intergenic
1192006034 X:67213569-67213591 AATCACCAGGCTGGGTGTGGTGG + Intergenic
1192158979 X:68768848-68768870 AAGCAAAAGATTGGGTGTGGAGG - Intergenic
1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG + Intronic
1192453473 X:71258266-71258288 AAATACAAGGCTGGGAGTGGTGG - Intergenic
1192586888 X:72326229-72326251 AATAATATGGCTGGGTGTGGCGG - Intergenic
1192832517 X:74765736-74765758 AATGTTGAGACTGGGTGTGGTGG + Intronic
1195367692 X:104141873-104141895 AGTCCTAGGACTGGGTGTGGTGG - Intronic
1195634284 X:107095723-107095745 ATTCAAAAGGCTGGGTGTGGTGG + Intronic
1195820243 X:108937246-108937268 AATCAAAAGCCTTGAAGTGGCGG - Intergenic
1195858591 X:109357005-109357027 AATGGTAAGCCTGGGGGTGGGGG + Intergenic
1196138338 X:112233902-112233924 AAAAATAAGGCCGGGAGTGGTGG + Intergenic
1196671919 X:118377249-118377271 ACTCAGAAGACTGAGACTGGAGG + Intronic
1196784459 X:119409901-119409923 AACCATACGGCTGGGCGTGGTGG - Intronic
1197022128 X:121704550-121704572 ACTAACAAGACTGGGAGAGGTGG - Intergenic
1197669646 X:129262436-129262458 AATCCTTGTACTGGGAGTGGGGG - Intergenic
1197981779 X:132224830-132224852 TATCATCAGGCTGGGTGTGGTGG - Intergenic
1198109918 X:133494070-133494092 TAACATAAGACTAGGAATGGAGG - Intergenic
1198460983 X:136862791-136862813 TATCATGGGACTGGGACTGGTGG - Intronic
1199067664 X:143439689-143439711 ACTCAGAAGACTGGGAGAGAGGG + Intergenic
1201164084 Y:11191837-11191859 AAAAATGAGACCGGGAGTGGTGG - Intergenic
1201558562 Y:15290732-15290754 AAATAAAAGGCTGGGAGTGGTGG - Intergenic