ID: 1006095353

View in Genome Browser
Species Human (GRCh38)
Location 6:31652743-31652765
Sequence TGAGCGCTAGAAGATTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006095346_1006095353 16 Left 1006095346 6:31652704-31652726 CCTCCCCCCTCTGGCGGCGTTCA 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095350_1006095353 10 Left 1006095350 6:31652710-31652732 CCCTCTGGCGGCGTTCACGTCTG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095347_1006095353 13 Left 1006095347 6:31652707-31652729 CCCCCCTCTGGCGGCGTTCACGT 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095351_1006095353 9 Left 1006095351 6:31652711-31652733 CCTCTGGCGGCGTTCACGTCTGT 0: 1
1: 0
2: 0
3: 3
4: 29
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095341_1006095353 22 Left 1006095341 6:31652698-31652720 CCACCCCCTCCCCCCTCTGGCGG 0: 1
1: 0
2: 3
3: 64
4: 738
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095343_1006095353 19 Left 1006095343 6:31652701-31652723 CCCCCTCCCCCCTCTGGCGGCGT 0: 1
1: 0
2: 1
3: 10
4: 190
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095349_1006095353 11 Left 1006095349 6:31652709-31652731 CCCCTCTGGCGGCGTTCACGTCT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095345_1006095353 17 Left 1006095345 6:31652703-31652725 CCCTCCCCCCTCTGGCGGCGTTC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095344_1006095353 18 Left 1006095344 6:31652702-31652724 CCCCTCCCCCCTCTGGCGGCGTT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095339_1006095353 24 Left 1006095339 6:31652696-31652718 CCCCACCCCCTCCCCCCTCTGGC 0: 1
1: 1
2: 10
3: 200
4: 2544
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095348_1006095353 12 Left 1006095348 6:31652708-31652730 CCCCCTCTGGCGGCGTTCACGTC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97
1006095340_1006095353 23 Left 1006095340 6:31652697-31652719 CCCACCCCCTCCCCCCTCTGGCG 0: 1
1: 0
2: 3
3: 54
4: 768
Right 1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006095353 Original CRISPR TGAGCGCTAGAAGATTGAGG TGG Intronic
905338344 1:37260614-37260636 GGAGCCCCAGAAGGTTGAGGGGG + Intergenic
907588253 1:55640972-55640994 TGTGTGCTAGAAGATTCAGAGGG - Intergenic
912459909 1:109823729-109823751 TGAAAACTAGAAGAGTGAGGTGG + Intergenic
917668338 1:177247611-177247633 TGAGCACTAAAAGTTGGAGGGGG + Intronic
919553908 1:199028064-199028086 TGGCCCCTAGAAGATTGAGAGGG - Intergenic
1067416182 10:46105180-46105202 TGAGGGCTAGGAAAATGAGGAGG + Intergenic
1067436325 10:46281672-46281694 TGAGGGCTAGGAAAATGAGGCGG + Intergenic
1070168687 10:73916342-73916364 TGAGCCCTAGAGAAGTGAGGAGG - Intronic
1070365490 10:75732886-75732908 TGAGCTGAAAAAGATTGAGGAGG + Intronic
1070556288 10:77530104-77530126 TGTTAGTTAGAAGATTGAGGAGG - Intronic
1074339519 10:112613644-112613666 TGAGCACTAAAAGGTTGAGAAGG + Intronic
1074439019 10:113458799-113458821 TGGCTGCTAGAAGATTGAGAAGG - Intergenic
1074732034 10:116389400-116389422 TGAAGGCTAGAAGTCTGAGGTGG + Intergenic
1074899216 10:117802188-117802210 TGAGCTCTGAAGGATTGAGGTGG + Intergenic
1075905904 10:126081952-126081974 TGAGAGCAAGATGATTCAGGAGG + Intronic
1079260815 11:18878441-18878463 AGAGCGATAAAAGAGTGAGGAGG + Intergenic
1079279498 11:19074611-19074633 TGAGCACTAGAAGAGGGAGACGG - Intergenic
1080393214 11:31866901-31866923 TGAGGGCAAGAAGATGCAGGGGG - Intronic
1084630119 11:70342374-70342396 TGGGGGCTTGAAGAGTGAGGTGG + Intronic
1087937360 11:104050341-104050363 GGAGTGATAGAGGATTGAGGAGG + Intronic
1088579539 11:111301052-111301074 TGAGTTCCAGAAGAATGAGGAGG - Intronic
1090544087 11:127743498-127743520 CGAGCACTTGAAGATTGAAGAGG - Intergenic
1094418555 12:30244627-30244649 TAAGCGCTAGAAAACAGAGGAGG - Intergenic
1103702663 12:122855843-122855865 TGAGAGCTTGAAGAGAGAGGTGG + Exonic
1106917801 13:34534023-34534045 TTTGAGCTAGAAGATTCAGGAGG - Intergenic
1108993568 13:56695277-56695299 TTAGAACTAGAATATTGAGGAGG - Intergenic
1110164363 13:72421013-72421035 TGTGTGCTAGATGAATGAGGTGG + Intergenic
1112983759 13:105420657-105420679 TGAGCATTAGAACATAGAGGGGG + Intergenic
1117728702 14:58699314-58699336 TGAGCTATAGAAGATTAAAGAGG + Intergenic
1117735310 14:58763119-58763141 TGAGCTATAGAAGTTTGATGAGG + Intergenic
1121285145 14:92729333-92729355 AGAGAGCTGGAAGAGTGAGGTGG - Intronic
1121925545 14:97924037-97924059 TGAGCACTTGAGGATTGAGTGGG - Intergenic
1134872406 16:17663831-17663853 TCAGAGCTAGCAGATTGAGGTGG + Intergenic
1135660371 16:24291496-24291518 TGAGAGCAAGAAGATGGAGGTGG + Intronic
1136929439 16:34406160-34406182 TGAATTCTAGGAGATTGAGGGGG - Intergenic
1136975135 16:35005644-35005666 TGAATTCTAGGAGATTGAGGGGG + Intergenic
1137353839 16:47738868-47738890 TTAATGCTAGTAGATTGAGGTGG + Intergenic
1138180453 16:54937347-54937369 TGGGACCTAGAAGATTGTGGGGG + Intergenic
1141946759 16:87315961-87315983 TGAGCCCAAGAAGAGTGAGAGGG + Intronic
1143494862 17:7307007-7307029 AGCGCGCTAGAAGAGTGGGGCGG + Exonic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1151227545 17:72658157-72658179 TGAATCCTAGAAGATGGAGGGGG + Intronic
1151485739 17:74398336-74398358 TGAGCCCCAGGAGGTTGAGGCGG + Intergenic
1152483025 17:80568673-80568695 AGAGCTCTGGAAGATTGAGGAGG - Intronic
1155635208 18:27944831-27944853 TGAGCCCAAGAAGTTTGAGGCGG + Intergenic
1158608628 18:58918704-58918726 TGACGACGAGAAGATTGAGGTGG + Exonic
1159236199 18:65676252-65676274 TGCGCAATAGAAGATGGAGGTGG + Intergenic
1160416425 18:78714758-78714780 TGAGCGTCAGAGGATGGAGGAGG + Intergenic
1161829393 19:6591360-6591382 TGGGCCCCAGAAGAATGAGGTGG - Intronic
1162515993 19:11148074-11148096 AGAGCTCAAGGAGATTGAGGCGG - Exonic
925021752 2:575228-575250 TGAGAGACAGAAGATGGAGGAGG + Intergenic
932376921 2:71244704-71244726 TGAGAGCTAGAAGACAGATGAGG - Intergenic
932819438 2:74887010-74887032 TCGGCGCTGGAAGATGGAGGAGG - Intronic
937492162 2:122381360-122381382 TGAGCTCTAAATGAATGAGGTGG + Intergenic
941500636 2:166271486-166271508 TGAGCACTAGGAGATAGAGCTGG + Intronic
943298616 2:186169402-186169424 TGAGCATTTGAAGAATGAGGCGG + Intergenic
1170520060 20:17175765-17175787 TGAGGGCTACAACATTTAGGAGG - Intergenic
1172914107 20:38431007-38431029 TGAGCTCTAGAGGACTGAGCAGG + Intergenic
1174049592 20:47758517-47758539 TGAGCGCTAAAAGGTGGAGGGGG + Intronic
1182864206 22:33588388-33588410 TGAGCTCTAGAAGAAAGATGAGG + Intronic
950854079 3:16089080-16089102 AGAGGGATAGAAGATTGAGTTGG + Intergenic
952495435 3:33911811-33911833 TGAGGGCTGGAAGAGTGAGGAGG + Intergenic
954701870 3:52454805-52454827 TGAGACCTAGAAGAGGGAGGTGG - Intergenic
958746679 3:98144177-98144199 TGTGGACTAGTAGATTGAGGAGG - Intergenic
959368709 3:105495389-105495411 TGAGCACTAGAAGAATGAACAGG + Intronic
962938928 3:140107830-140107852 TGAGAATTAAAAGATTGAGGAGG - Intronic
964118997 3:153162810-153162832 TTACCGCAAGGAGATTGAGGTGG + Exonic
967705090 3:192640891-192640913 TGAAGGCCAGGAGATTGAGGGGG - Intronic
970484147 4:16507517-16507539 TGAGAGCAAGAAGGGTGAGGGGG + Intronic
970617115 4:17778601-17778623 TGAGCTTTGGAAGGTTGAGGCGG + Intronic
971694724 4:29885725-29885747 TGACCTCTAGAAGCTGGAGGAGG + Intergenic
972205055 4:36761796-36761818 TGAGAGCAAGAAGATTGAGGTGG + Intergenic
972241920 4:37202819-37202841 TGCGTGCTAGAAGATGGAGTTGG - Intergenic
975820691 4:78267629-78267651 TGAGAGCTAAAAGATCCAGGGGG - Intronic
978240852 4:106514632-106514654 TGAGGGGTAGAATTTTGAGGGGG - Intergenic
979804109 4:124949584-124949606 TGAGAGCTATAAGATTTAGATGG + Intergenic
984791159 4:183616341-183616363 TGATGGCTTGAAGATAGAGGAGG - Intergenic
986847913 5:11777516-11777538 TGAGACCTGGAAGATGGAGGTGG + Intronic
987465985 5:18272668-18272690 TGAGGGCTAGAAGATAGAGATGG + Intergenic
988206192 5:28138422-28138444 TGAGGGCTAGGAAAATGAGGCGG - Intergenic
989247840 5:39273777-39273799 TGAGGTCTAGAAGAATGGGGTGG + Intronic
990316105 5:54584756-54584778 TGACCACCAGAAGAATGAGGAGG + Intergenic
991904047 5:71490152-71490174 TGAGGGCTAAGAGTTTGAGGGGG + Intronic
995306144 5:110653102-110653124 TGAGCGCTAGAAGATAAATCAGG + Intronic
999420032 5:151432751-151432773 TGATGGCTTGAAGATGGAGGTGG + Intergenic
1000121024 5:158198007-158198029 TGAGAGCCAGCAGAGTGAGGTGG + Intergenic
1003843876 6:10152001-10152023 TGAGCTTTAAAAGATTGAGTGGG - Intronic
1006095353 6:31652743-31652765 TGAGCGCTAGAAGATTGAGGTGG + Intronic
1006483192 6:34315245-34315267 TGAAAGCTAGAAAATTGAGGAGG - Intronic
1013486006 6:110596751-110596773 TGAGCTATAGAAGATTGATTGGG - Intergenic
1037626187 8:20609120-20609142 AGAGCCCAAGAAGAATGAGGAGG - Intergenic
1037960170 8:23091859-23091881 TGTGTTCTAGAAGATTGCGGAGG + Intronic
1039243885 8:35586467-35586489 TCAGGGCTGGAGGATTGAGGTGG + Intronic
1039905158 8:41781249-41781271 AGAGGGCCAGGAGATTGAGGTGG - Intronic
1042501935 8:69518111-69518133 TGAGTACTAGAAGATGGCGGTGG - Intronic
1043737290 8:83764742-83764764 ACAGGGCTAGCAGATTGAGGTGG - Intergenic
1044329823 8:90904613-90904635 AGAGACCTAGAAGATTGAGTGGG + Intronic
1045886616 8:107106195-107106217 TTAGCTCTTGAAGATTGAGTAGG + Intergenic
1048771804 8:137903288-137903310 TGAACACTAGAGGACTGAGGTGG - Intergenic
1051053442 9:12956416-12956438 TGAGTGCTAAAAGTGTGAGGGGG - Intergenic
1052291944 9:26852169-26852191 TGAGCCCTGGGAGACTGAGGTGG - Intronic
1055527908 9:77153906-77153928 AGAGAGATTGAAGATTGAGGAGG + Intergenic
1062591736 9:137277558-137277580 TGAGCGCTAGAGAACTGAAGCGG + Intergenic
1186128727 X:6443588-6443610 TGAGAGCAAGATCATTGAGGAGG - Intergenic
1186836995 X:13448075-13448097 TGAGAGCTACCAGATTGAGCAGG - Intergenic
1188646083 X:32568997-32569019 AGAGCTCTAGAAAATTCAGGTGG + Intronic
1192596198 X:72410934-72410956 TGAGTGAGAGAAGAGTGAGGTGG - Intronic