ID: 1006096972

View in Genome Browser
Species Human (GRCh38)
Location 6:31662183-31662205
Sequence CCCAGGAAGGGGAAGTCAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006096964_1006096972 17 Left 1006096964 6:31662143-31662165 CCTATTGACCAAAAACTTCAGGA 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG 0: 1
1: 0
2: 0
3: 34
4: 331
1006096965_1006096972 9 Left 1006096965 6:31662151-31662173 CCAAAAACTTCAGGATCTGCATC 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG 0: 1
1: 0
2: 0
3: 34
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006096972 Original CRISPR CCCAGGAAGGGGAAGTCAAA GGG Exonic
900646345 1:3710371-3710393 CCCAGGGAGGGGCAGGCAAGTGG + Intronic
901166532 1:7225507-7225529 CCCAGGAAAGGGAAGTTCCAAGG - Intronic
901758237 1:11454310-11454332 CCCAGGCTGGGGAAGGAAAACGG + Intergenic
902048219 1:13541912-13541934 CTCAGGAAGGAGCAGTCAAGGGG - Intergenic
902747832 1:18484960-18484982 ACCAGGAAGGGAAAGTCAGCTGG + Exonic
903836009 1:26203699-26203721 CCCAGGAAGTGGAAGACCCATGG + Intergenic
905295632 1:36952754-36952776 GCCAGGAAGGAAAAGCCAAAAGG + Intronic
905395217 1:37662373-37662395 CACAGGCAGAGGAAGTGAAAAGG + Intergenic
905834792 1:41108377-41108399 CAGAGCAAGGGGAAGTCAAGTGG + Intronic
905979830 1:42214496-42214518 AACAGGAAGTGGAACTCAAATGG - Intronic
906678240 1:47708627-47708649 CCCAGGGAGGGGAAGGCCAGGGG + Intergenic
907312998 1:53550470-53550492 CCCAGAATGGAGATGTCAAAGGG - Intronic
907541108 1:55215753-55215775 GCCAGGGAGGGGAAGTCCAACGG - Intergenic
908072925 1:60483317-60483339 CCCAGGATGGGGGAGGTAAATGG + Intergenic
908175093 1:61547576-61547598 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
908437676 1:64122326-64122348 CCCAGAAAGCTGAAGTCAAGAGG - Intronic
908612850 1:65881666-65881688 CCCAGGAAAGGGAACTGAGAAGG - Intronic
908763740 1:67535918-67535940 CCCAGGAAGCGGAAGTTGCAGGG - Intergenic
909116383 1:71542323-71542345 CACCAGAAGGGGAAGTCAGATGG + Intronic
910058407 1:83059473-83059495 CCCTGGCAGGAGGAGTCAAATGG + Intergenic
910077628 1:83299105-83299127 CCCTGGTAGCGGAAGACAAAGGG + Intergenic
913963743 1:143357957-143357979 CCCAAGATTGGGAAGCCAAAGGG + Intergenic
914058104 1:144183561-144183583 CCCAAGATTGGGAAGCCAAAGGG + Intergenic
914121042 1:144782810-144782832 CCCAAGATTGGGAAGCCAAAGGG - Intergenic
915218128 1:154353363-154353385 CCCAGGCAGGGGAAAGGAAAGGG - Intergenic
915420840 1:155780096-155780118 GCCAGGAAGAGGAATTTAAAGGG + Intronic
916742691 1:167660346-167660368 CCCAGGAAGGAGAAGTGATGGGG - Intronic
917319008 1:173759298-173759320 CCCTGGTAGTGGAAGACAAAGGG + Intronic
917759460 1:178140954-178140976 CTCAGGAAGCGGAAGGCAGAAGG + Intronic
919531402 1:198725664-198725686 ACCAGGGAGGAGAAGACAAAAGG - Intronic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
920004491 1:202823067-202823089 CCCAGGAGGCGGAGGTCATAGGG + Intronic
920172147 1:204078763-204078785 CTAAGGAAGGGCCAGTCAAAAGG - Intronic
920394610 1:205635146-205635168 CCCAGAAAGGGTAAGTCGCAAGG - Intergenic
920593878 1:207249171-207249193 CACAGGCAGGGGGAGTCAAAAGG + Intergenic
920727015 1:208445763-208445785 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
920992195 1:210950151-210950173 CCCAGGCAGGGGAGGGCAAGTGG + Intronic
921309942 1:213832896-213832918 CACAGGAAGGGGAGGTCTATGGG - Intergenic
921836690 1:219785503-219785525 CCCAGGGAGGGGAATTTATAGGG + Intronic
924703807 1:246481528-246481550 CCCAGGAAAGTGGAGTCCAATGG - Intronic
1062965908 10:1607709-1607731 TCCAGGCAGGGGACGTCACACGG + Intronic
1063740741 10:8816347-8816369 CCCATCAAGTGCAAGTCAAATGG + Intergenic
1064635299 10:17359026-17359048 CCCAGGAAGGAGGTGTCAACTGG - Intronic
1065382146 10:25101445-25101467 CTCAGGAAGTGGAACTCTAAAGG - Intergenic
1065421455 10:25549259-25549281 CTTAGGAGGGGGAAGACAAATGG - Intronic
1066145484 10:32553897-32553919 CCCTGGTAGGGGAAGACAAAGGG - Intronic
1067069405 10:43120858-43120880 CCCAGGCAGGGCAAGTTCAAGGG + Intronic
1068072260 10:52209861-52209883 CACAGGGAGGGGAGGTCAACTGG - Intronic
1068096599 10:52499358-52499380 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1069653184 10:70066414-70066436 CCAAGAAAGAGGAAGTCATAGGG + Intronic
1069754033 10:70762294-70762316 CCCAGGGAGGGGAGGGCAACAGG - Exonic
1071565719 10:86670418-86670440 CCCAGGCAGGGGAGGCCACAGGG - Intronic
1072019002 10:91380108-91380130 ACAAGGAAGAGGAAGTCACAAGG + Intergenic
1073446327 10:103582583-103582605 TCCTGGAAGGGGCAGTGAAAGGG + Intronic
1073645074 10:105293530-105293552 TCCAGGAAGGGGATGTCAACAGG - Intergenic
1075592518 10:123703059-123703081 CCCAGAAAAGGAAAGACAAAGGG + Intergenic
1077885682 11:6385964-6385986 CCCAGGAATGTGAAGATAAAGGG - Intergenic
1077978701 11:7276634-7276656 ACCAGGAGGGGGAAGGCAGAGGG - Intronic
1077991738 11:7418170-7418192 CCCAGGACTGGGAAGGCAGAGGG + Intronic
1078639977 11:13085357-13085379 ACCAGGAAGAGGAAGGGAAAGGG - Intergenic
1078912724 11:15748052-15748074 CCCAAGAGGGAGAAGTCAATTGG + Intergenic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1080798663 11:35589287-35589309 CCTGGGAAAGGGAAGGCAAAGGG + Intergenic
1081233362 11:40614789-40614811 CCCAAGAAGGAGAAGACAGATGG + Intronic
1081425731 11:42924652-42924674 CCCAGGAAGGCCAGGTCATAGGG + Intergenic
1082653590 11:55824997-55825019 CTCCAGAAGGGGAATTCAAAAGG + Intergenic
1083123449 11:60538698-60538720 CCCAGGAAGTGAAAGTCATAGGG - Intronic
1084030176 11:66476415-66476437 CCCAGGAAGGGCAAGGCCATGGG - Exonic
1085027054 11:73242530-73242552 CCCCGGAAGTGGAAGTGGAATGG + Intergenic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1087275927 11:96160501-96160523 CCCTGGAAGGGGAGGTTACAGGG - Intronic
1089082641 11:115789714-115789736 CCCAGGATGGGGAAGGGACAGGG + Intergenic
1090267752 11:125364173-125364195 CCCAGGAACTGGAGCTCAAAAGG - Intronic
1090802364 11:130180938-130180960 CCCGGGAAGGGGAAGTGGAGAGG - Intronic
1091210509 11:133854384-133854406 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1092693585 12:11144164-11144186 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1093172591 12:15876112-15876134 CCCAGGTAGTGGAAGACAAAGGG + Intronic
1093720593 12:22437515-22437537 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1095615755 12:44186261-44186283 CCTTGGAAAGGCAAGTCAAAAGG - Intronic
1096572494 12:52531692-52531714 TCCAGGAAGGGGAGGTGGAAGGG - Intergenic
1097760572 12:63459594-63459616 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1098960905 12:76739068-76739090 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1099310991 12:81022632-81022654 CTCACCAAGGGGAAGCCAAACGG - Intronic
1099655268 12:85480877-85480899 CCCAGGATGGGCAAATCTAATGG + Intergenic
1100290972 12:93214817-93214839 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1100380530 12:94057593-94057615 CCCTGGAATTTGAAGTCAAAGGG - Intergenic
1101399930 12:104378313-104378335 CCCAGAAAGGGGAAGGCCAGGGG + Intergenic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1102630574 12:114275131-114275153 CCCGGAAAGGGGGTGTCAAAGGG - Intergenic
1102956725 12:117063699-117063721 TGCAGGAAGGGGAACTCAGAGGG - Intronic
1103200295 12:119082653-119082675 TCCAGGATGAGGAGGTCAAACGG - Intronic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104468609 12:129010019-129010041 CCCAGGCAGGGGAGGTGATAAGG - Intergenic
1104661820 12:130616827-130616849 CACAGGAAGGAGAAGTCAGAGGG + Intronic
1105706658 13:22971554-22971576 CCCAAGCACGGGAAGCCAAAAGG + Intergenic
1106168219 13:27267874-27267896 TCCATAAAGGAGAAGTCAAAAGG + Intergenic
1106938130 13:34747146-34747168 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1108740326 13:53330856-53330878 CCCAGGTGGGGGCAGTGAAAAGG - Intergenic
1109162927 13:58998655-58998677 CTCAGCAAGGGGAAAACAAAAGG + Intergenic
1109642219 13:65205303-65205325 CCCAGGAAAGGAAAGCCAGATGG + Intergenic
1109761480 13:66835397-66835419 CCCAGGAAGGGAATATAAAATGG + Intronic
1110345842 13:74446823-74446845 CCCAGAAAGAGAAAGTCAAAAGG - Intergenic
1112035341 13:95492240-95492262 CCCTGGTAGGGAAAGACAAAGGG - Intronic
1112310148 13:98310910-98310932 CCTAAGAAGGAGAGGTCAAAGGG + Intronic
1114410041 14:22492330-22492352 CCCAGCAAGGGACAGTCAGAGGG + Intergenic
1114580184 14:23750258-23750280 CACAGGATGGGGAAGTCCCAAGG - Intergenic
1117844791 14:59899879-59899901 ACCAACAAGGGGAAGTAAAATGG - Intergenic
1118435265 14:65765383-65765405 CCCAGGGAGGGGAGGTTAGATGG + Intergenic
1118460338 14:65981332-65981354 CCCAGGACAGGGCAGACAAAAGG + Intronic
1120852562 14:89184653-89184675 CCCAGGAAGGTGAAGGCACTAGG - Intronic
1122130347 14:99601632-99601654 CCCAGGACGGCAAAATCAAAGGG + Intronic
1122830571 14:104393662-104393684 CGCAGGAGGGGAAAGGCAAAGGG - Intergenic
1122857331 14:104566101-104566123 ACCATGAAGGGGAAGACAGATGG + Intronic
1123051682 14:105547133-105547155 CCCCGGAAGTGGAAGTGGAAGGG - Intergenic
1123077095 14:105672836-105672858 CCCCGGAAGTGGAAGTGGAAGGG - Intergenic
1124109036 15:26770419-26770441 CCCAGTAAGAGAAAGACAAATGG - Intronic
1124230519 15:27941727-27941749 CTCAGGAAGGGAGATTCAAATGG + Intronic
1125756547 15:42069229-42069251 GCCAGAAGGGGGAAGTCAACTGG + Intronic
1126249970 15:46555876-46555898 CCCAGGAAGGGAAAGGAGAAGGG + Intergenic
1128039483 15:64558237-64558259 CAAGGGAAGGGGAAATCAAAGGG - Intronic
1129210374 15:74064742-74064764 CCCAGGATGGTGAAGCTAAAAGG - Intergenic
1129403650 15:75300659-75300681 CCCAGGATGGTGAAGCTAAAAGG + Intergenic
1129862909 15:78876690-78876712 CCCAGGAACGAGAACTAAAATGG - Intronic
1130745809 15:86652826-86652848 CTCTGGCAGGGGAAGTGAAAAGG - Intronic
1130950916 15:88587007-88587029 CCCAGGAAGGGGGAGCAAGAAGG - Intergenic
1131717689 15:95131272-95131294 CACAGGAAGGGGAAATGAAGAGG - Intergenic
1133255001 16:4511318-4511340 CCCAGGGCGGGGGAGTGAAAGGG + Exonic
1134339731 16:13334021-13334043 GCATGGATGGGGAAGTCAAATGG - Intergenic
1135502419 16:23008112-23008134 CCAAGGATGGAGAAATCAAAGGG + Intergenic
1136115331 16:28090970-28090992 CCCAGGAAGGGGAAGGAACTGGG + Intergenic
1136597335 16:31260355-31260377 CCCAGGGAGGAGAAGTGACATGG + Intronic
1140535433 16:75705210-75705232 CCCAGGGAGGGGAAGCCTCAAGG - Intronic
1142707956 17:1708448-1708470 CCCAGGAATGGGAGGTTAAGGGG - Intronic
1143041136 17:4037657-4037679 CCCAGGAGGTCGAAGTCATAGGG - Intronic
1143186423 17:5013018-5013040 CCCAGGGAGGGGTAGTCACTGGG + Intronic
1143474992 17:7197299-7197321 CCAGGGATGGGGAAGTCAAAGGG + Intronic
1143712636 17:8744904-8744926 CCCAGCAAGGGGAGGACCAATGG - Intronic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144139656 17:12336464-12336486 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1144889485 17:18486094-18486116 ACCAGGAAGCAGAGGTCAAAGGG - Exonic
1145142726 17:20458202-20458224 ACCAGGAAGCAGAGGTCAAAGGG + Exonic
1145793194 17:27640732-27640754 ACCAGGAAGCAGAGGTCAAAGGG - Exonic
1148095084 17:45046907-45046929 ACCAGAAAGGGCAATTCAAAAGG + Intronic
1148804207 17:50256146-50256168 CCCAAGAAGGGGAGTTCAAGGGG - Intergenic
1148948384 17:51286403-51286425 CCCTGGGATGGGAAGTCAAGGGG + Intronic
1149336931 17:55644983-55645005 TCCAGGAAGTAGAAGTCTAAGGG + Intergenic
1150686464 17:67325112-67325134 AGCAGGAAGGGGAGGTGAAAAGG - Intergenic
1151338013 17:73451686-73451708 CGCAGAGAGGGCAAGTCAAAAGG - Intronic
1151759072 17:76090489-76090511 TCCAGGAGGGGGACGTCAGATGG + Intronic
1151913470 17:77100360-77100382 CCAAGGAAGGGGAAATTAACAGG - Intronic
1152135636 17:78501639-78501661 CCCAGGAAGAGGAAGTGGCAGGG + Intronic
1153965912 18:10182018-10182040 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
1154056928 18:11021892-11021914 ACTAGGAAAGGGAAGTCCAAGGG - Intronic
1158711821 18:59844575-59844597 CCCAGGAAGCAGAAGTTACAGGG - Intergenic
1159924933 18:74260420-74260442 CCAAGGAAAAGTAAGTCAAAAGG + Intronic
1160219742 18:76965960-76965982 CCCTGGAAGCGGAAGACAAAGGG - Intronic
1160305227 18:77727526-77727548 CCCAGGAAAGGAGAGTGAAAAGG - Intergenic
1160656916 19:277696-277718 CTCAGAAATGGGAAGTCAAGAGG + Intergenic
1163127437 19:15251831-15251853 GCCAGGATTGGGAAGACAAAAGG + Intronic
1163370894 19:16900707-16900729 CCCAGAAAGGGGAGGAAAAAAGG + Intronic
1163625500 19:18387033-18387055 CCCAGGAGGGGGCAGGCAGAGGG + Intronic
1164161453 19:22627944-22627966 CCCAGGAAAGAGACCTCAAAAGG + Intergenic
1165609788 19:37141433-37141455 CCCATGAAGGGAAGGTAAAAAGG + Intronic
1165819996 19:38668811-38668833 CCCATGAAGGCGAAGTCAATGGG - Intronic
1165989073 19:39795942-39795964 CCCAGGAAGGGAAAATCTTAAGG + Intergenic
1166073373 19:40399176-40399198 CCCAGGAACAGGAAGGCGAATGG - Intronic
1166258504 19:41621770-41621792 TGCAGAAAGGGGAAGGCAAAGGG + Intronic
1166411137 19:42555925-42555947 TGCAGAAAGGGGAAGGCAAAGGG + Intronic
1167508488 19:49883477-49883499 GCCAGGAAGGTGAAGTGTAAGGG + Intronic
1168355053 19:55695455-55695477 CCCAGGAAGGGGAAGGGCACTGG - Intronic
1202697587 1_KI270712v1_random:136218-136240 CCCAAGATTGGGAAGCCAAAGGG + Intergenic
925527880 2:4823714-4823736 CCCAAGAAGAGGAAGAGAAATGG - Intergenic
926106695 2:10156712-10156734 CCCAGGAGGCGGAAGTTACAGGG - Intronic
927553274 2:24016786-24016808 CCCAGACAGGGGAACACAAAGGG - Intronic
928733759 2:34261804-34261826 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
930032880 2:47069170-47069192 CCCAGGAAGGGGAGGAGAAAAGG + Intronic
930034070 2:47074778-47074800 CTCAGGCAGGGGAAGCCAAAAGG - Exonic
930066645 2:47332713-47332735 GCAAGGAAGGGGAAGTCAGGTGG + Intergenic
930267818 2:49220467-49220489 CAAAGGAAGGTGAAGTCAATGGG + Intergenic
931547896 2:63408964-63408986 CCCTGGTAGTGGAAGACAAAGGG + Intronic
933045197 2:77526409-77526431 CCCAGGAAGTGGAGGTTAGAGGG + Intronic
933531540 2:83517840-83517862 CCCTGGTAGCGGAAGACAAAGGG + Intergenic
934278760 2:91593214-91593236 CCCAAGATTGGGAAGCCAAAGGG + Intergenic
934757097 2:96832091-96832113 GCCAGGAAAGGGAAGTGAAGGGG - Intronic
937384036 2:121409675-121409697 CCTGGGAAGTGGAGGTCAAAGGG - Intronic
938038057 2:128053099-128053121 CCCTGGTAGCGGAAGACAAAGGG - Intergenic
938042954 2:128091169-128091191 TGCAGGAAGCGGAAGTAAAAGGG + Intergenic
941024788 2:160446747-160446769 CCGAGGAATGGGGAGTAAAATGG - Intronic
943349984 2:186785692-186785714 CCCAGTGAGGAGAAATCAAATGG - Intergenic
944634398 2:201660796-201660818 CCCAGGAAGGGGAAGGAATGAGG - Intronic
945004619 2:205391097-205391119 CCTGGGAAGGGCAAGTCAAACGG + Intronic
945271433 2:207944231-207944253 CCAAGGCAGGAGAATTCAAAAGG + Intronic
945627425 2:212228092-212228114 CCAAGGAGGGGGAGGTGAAAAGG - Intronic
946001594 2:216486928-216486950 CTCAGGAAAGGGAACTAAAAAGG - Intergenic
947403588 2:229752214-229752236 ATCAGGATGGGGAAGTCAGAAGG + Intergenic
948222809 2:236287051-236287073 CCCAGGAAGGGTGAGTCAGAAGG + Intergenic
948979443 2:241485513-241485535 CCCAGGAAGGGGAGATCACAGGG - Intronic
948979491 2:241485665-241485687 CCCAGGAAGGGAAGATCACAGGG - Intronic
1168876718 20:1176944-1176966 CCCAGGGAGAGGAAGGCAAATGG + Intronic
1169182755 20:3584424-3584446 CCCAGGATGTTGAAGGCAAAAGG - Intronic
1170175970 20:13470312-13470334 CCCAGAAAGGGGCAAGCAAAAGG + Intronic
1170245743 20:14220104-14220126 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1171165617 20:22967611-22967633 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1173365436 20:42380594-42380616 CCCAGGAAAGGGCTGCCAAAGGG + Intronic
1173807500 20:45935263-45935285 CCCAGTAGGGAGGAGTCAAAGGG - Intronic
1175272571 20:57745081-57745103 CCCAGTTTGGGAAAGTCAAATGG + Intergenic
1175674945 20:60938323-60938345 CCCAGGGAGGGGAGGTGCAAAGG + Intergenic
1175829068 20:61952207-61952229 GCCAGGCAGGGGAAGTCAGCTGG + Intergenic
1175838855 20:62014217-62014239 CACAGGAAGGTGAAGCCACAGGG + Intronic
1177194046 21:17883475-17883497 GCCAGAAAGGGGCACTCAAATGG - Intergenic
1177770743 21:25512842-25512864 CCCAAGAAAGAGAAGTGAAAAGG + Intergenic
1180140660 21:45891866-45891888 CCCAGGAGGCTGAGGTCAAAGGG - Intronic
1180725212 22:17941882-17941904 CCCAGGAGGGGGAAAGCAGAAGG + Intronic
1181259646 22:21588259-21588281 TCCAAGAAGTGGAATTCAAAAGG - Intronic
1185023441 22:48394054-48394076 CCCAGAAAGGGGAAGCCAGATGG - Intergenic
950114361 3:10441085-10441107 CCCAGGAAAGGGAGGTGCAAAGG - Intronic
950637336 3:14324274-14324296 CCCAGGCAGGGGAAATCGAGGGG - Intergenic
956716534 3:72085099-72085121 CCCAGGAAGGGGATATCACTTGG - Intergenic
957427930 3:80064029-80064051 CCCTGGCAGTGGAAGACAAAGGG + Intergenic
958505632 3:94973706-94973728 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
959101980 3:102021116-102021138 CCGAGGAAGAGGAAGAAAAATGG - Intergenic
961320382 3:126069008-126069030 CTGAGGAAGGGGATGTCAACAGG + Intronic
961701583 3:128748736-128748758 CCCAGGAAGAGGAACACAATAGG - Intronic
961708629 3:128809408-128809430 CCCAGGGAGGGGAACTCAGAGGG - Intronic
961715322 3:128853724-128853746 CCCACAGAGGGGAAGTCAGAGGG - Intergenic
961767946 3:129226854-129226876 GCCAGGAAGAGACAGTCAAAGGG - Intergenic
963107051 3:141656381-141656403 AGGAGGAAGGTGAAGTCAAAGGG - Intergenic
963383610 3:144562137-144562159 CTCAGGAAGTGAAAGTCAAGAGG + Intergenic
963680107 3:148363698-148363720 CCCAGAAAGGGGGAGGGAAAAGG - Intergenic
964394742 3:156233692-156233714 CCCAGGCAGGGGAAGTATAGTGG + Intronic
964724601 3:159801078-159801100 CCCAGGACTGGGGAGTGAAAAGG - Intronic
965052692 3:163671250-163671272 CCCTGGTAGTGGAAGACAAATGG - Intergenic
965190622 3:165523556-165523578 CTCAAGAAGGAGAAGTCAGAGGG - Intergenic
965795161 3:172432052-172432074 CCCAAGACTGGGAAGACAAAGGG + Intergenic
966220244 3:177544441-177544463 TCCAGGCAGGGAAAGCCAAATGG + Intergenic
966770545 3:183499936-183499958 CTCAGGGAGGTGAAGTCACATGG - Intronic
967209099 3:187150702-187150724 CCCAGGCAGCAGAAGACAAAGGG + Intronic
967389463 3:188941271-188941293 CCCAGAAAGGGGAAATGAAAGGG + Intergenic
968082284 3:195854791-195854813 CCCAGGAAGGAGAAGGCCGACGG - Intergenic
969032031 4:4223275-4223297 CCCAAGATTGGGAAGCCAAAGGG - Intronic
969380551 4:6794116-6794138 CCGACCAAGTGGAAGTCAAAAGG - Intronic
973960624 4:56106256-56106278 CTCATGCAGGGGAAGTCTAAAGG - Intergenic
975306928 4:72860534-72860556 CCCTGCAAGGGGAGGTCCAAGGG + Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
975680230 4:76868445-76868467 CCCTGGTAGGGGAAGACAAAGGG + Intergenic
976686325 4:87819372-87819394 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
976856500 4:89610339-89610361 CCCTGGTAGCGGAAGACAAAAGG + Intergenic
979184365 4:117770470-117770492 AGCAGGAAGGGGAACTGAAAAGG - Intergenic
981084940 4:140673901-140673923 CCCGGGAGGGGGAAGCCAGAAGG + Intronic
981346661 4:143684072-143684094 CCCTGGTAGTGGAAGACAAAGGG + Intronic
981719972 4:147791658-147791680 CCCAGGAGGCGGAAGTTACAGGG - Intronic
983976951 4:173946092-173946114 CCCAGAAAGTGGAAGTGAAGAGG - Intergenic
984527533 4:180875357-180875379 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
987005997 5:13709878-13709900 CCCTGGTAGTGGAAGACAAACGG + Intronic
987008781 5:13738704-13738726 CACAGGAAGAGGAAGCCCAAAGG + Intronic
988042457 5:25907604-25907626 AACAGAAAGGGAAAGTCAAAAGG - Intergenic
988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG + Intergenic
988559835 5:32270817-32270839 CAAAGGAAGAGGAAGTCAAAAGG - Exonic
988902248 5:35745737-35745759 CCCTGGTAGTGGAAGACAAAGGG + Intronic
990227177 5:53667547-53667569 CCCAAGAGGGGCAAGTCAGAAGG - Intronic
990233355 5:53739403-53739425 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
990776197 5:59308820-59308842 CCCTGGGAGTGGAAGACAAAGGG - Intronic
991914166 5:71589442-71589464 TCCAGGAATGGGAAGACACATGG - Intronic
993295474 5:86133507-86133529 CCCAGGAAGTTGCAGTCAAGGGG + Intergenic
993827232 5:92706183-92706205 TAAAGGAAGGGGAATTCAAAAGG + Intergenic
994568350 5:101482840-101482862 CCCAGGTAGTGGAAGACAAAGGG - Intergenic
995029096 5:107459510-107459532 CCCAGAAAGGTGAAGTCACTTGG + Intronic
995039035 5:107567610-107567632 CCCAAGAAAGGGAAGACAAAAGG + Intronic
995472987 5:112523198-112523220 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
995638154 5:114219431-114219453 CGCAGGAAGGGGAGCTGAAAAGG + Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
998390259 5:141782967-141782989 CACAGGCTGGGGAAGTCAAAGGG - Intergenic
999171557 5:149599370-149599392 CTCAGGCAGGGGAACCCAAAAGG + Intronic
999873654 5:155778097-155778119 GACATGAAGGGGATGTCAAAAGG + Intergenic
1000198664 5:158986197-158986219 CCAAGGAAGGGGGAGATAAAAGG - Intronic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000253454 5:159516483-159516505 CCCAGGAATGGGAAGTGACCAGG + Intergenic
1000379254 5:160614336-160614358 CCCAGCTAGGGGAAGCCAACAGG + Intronic
1003495643 6:6660975-6660997 CCCAGGAAGAGGGAGCTAAAGGG + Intergenic
1003718593 6:8674893-8674915 ACCAGGATAGGGAAGTAAAAAGG + Intergenic
1004027901 6:11837028-11837050 CCCATGGAGGGCAAGCCAAAGGG + Intergenic
1005191408 6:23228398-23228420 CCCTGGTAGTGGAAGACAAAGGG - Intergenic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1007192882 6:40034806-40034828 CCCAGGAACTAGAAGTTAAAGGG - Intergenic
1007662290 6:43494365-43494387 CCCATGAAGGTGAAGTGAGAAGG - Intronic
1009453199 6:63825318-63825340 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1013400783 6:109794429-109794451 CACAGGAAGGGGTACTCACAGGG - Intronic
1014603925 6:123448651-123448673 CCCAGGTAGCAGAAGACAAAAGG + Intronic
1015224384 6:130839971-130839993 CACAGGACTGGAAAGTCAAAAGG + Exonic
1015367325 6:132411008-132411030 CCCAGAAAGAGGAAGCCAAATGG + Intergenic
1016393528 6:143598637-143598659 GCCAGGAAGGGGAAGCCATGTGG - Intronic
1017043615 6:150327251-150327273 CCCAGAGAGGGGAAGTCAAGAGG - Intergenic
1020915266 7:14184696-14184718 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1022625636 7:32033106-32033128 CCCAGGCAGGGCAAGGCAGAAGG + Intronic
1022949240 7:35319843-35319865 CCAAGGAGGGAGAGGTCAAAGGG + Intergenic
1023974144 7:45015444-45015466 TCCAGGAAGGGGAAGGGGAAGGG - Intronic
1024119105 7:46219513-46219535 TCCAGGAGTGGGAAGTCAGAAGG + Intergenic
1026682787 7:72481026-72481048 CCCGGGAAGCGGAGGTCACAGGG - Intergenic
1028182939 7:87747558-87747580 CCCTGGCAGCGGAAGACAAAGGG - Intronic
1029573723 7:101388989-101389011 CCCAAGAAGGGGAAGCCCCATGG - Intronic
1031007564 7:116491091-116491113 ACCAGGGAGGAGAAGTGAAATGG + Intronic
1032059832 7:128715275-128715297 TGCAGGAAGGGGAAGTGCAAAGG - Intronic
1034147940 7:148888712-148888734 CACAGGAAGGGGAAGAAAAGTGG + Intergenic
1034324074 7:150213626-150213648 CCCAGGAGGGGGAAGTTCTATGG + Intergenic
1034597527 7:152212217-152212239 CCAAGGAAGGGATGGTCAAAAGG + Intronic
1034903135 7:154920234-154920256 CCCAGGAAGGGGGACTGGAAGGG + Intergenic
1035914291 8:3601947-3601969 CCCAGGAACAGGAAGTACAATGG + Intronic
1036477800 8:9109563-9109585 CCCAGGAAGGGGAGAACAGAGGG - Intronic
1037906975 8:22721298-22721320 CCCAGGGAGGGGAGGTCACCTGG + Intronic
1038692425 8:29775330-29775352 CTCAAGATGGGAAAGTCAAAGGG + Intergenic
1038938675 8:32280235-32280257 CCCTGCCAAGGGAAGTCAAACGG - Intronic
1041108608 8:54465761-54465783 CCCAGTAGGGGGAAGAAAAAAGG - Intergenic
1041227787 8:55717259-55717281 CCCTGGTAGCGGAAGACAAACGG + Intronic
1041548619 8:59075772-59075794 GCAAGGAAGGTGGAGTCAAAGGG + Intronic
1042312620 8:67393837-67393859 CGCAGGAGAGGGAAGGCAAATGG + Intergenic
1044559947 8:93603123-93603145 CACAGGAAGGGGACATCAGAGGG + Intergenic
1044955683 8:97476888-97476910 CCTAGGAAGGGGGAGGGAAAGGG + Intergenic
1046409758 8:113826230-113826252 CCCAGGAATTGGAATTCATATGG - Intergenic
1048180898 8:132193317-132193339 CCCAGGTTGGGGAGGACAAAAGG + Intronic
1048251043 8:132866982-132867004 CCCAGGAAGGGCCAGGAAAATGG + Exonic
1049608028 8:143538750-143538772 CCCAGGATGGTGAAGTCAGTGGG - Exonic
1050411730 9:5373302-5373324 GCAAGGAAGAGGAAGTCACAAGG - Intronic
1050420417 9:5458507-5458529 CCCAGGAATGGAAAGACCAAGGG - Intronic
1050502709 9:6315371-6315393 CCCTGGTAGCGGAAGACAAACGG + Intergenic
1050513187 9:6415281-6415303 CCCTGGAAGAGGAAGTACAACGG - Intronic
1050697909 9:8299506-8299528 CACAGGAAAGGGAAGTCTTAAGG + Intergenic
1055346964 9:75349944-75349966 CCCTGGTAGGGAAAGACAAAGGG - Intergenic
1055376118 9:75649411-75649433 AGCAGGAAGGGGAGGTGAAAAGG + Intergenic
1055960965 9:81820093-81820115 CCCAGGCAGAGAAAGTCAACAGG + Intergenic
1055972762 9:81928328-81928350 CCCAGGAAGGTGGAGTCAGCTGG + Intergenic
1055974515 9:81943400-81943422 CCCAGGAAGGTGGAGTCAGCTGG + Intergenic
1058856162 9:109064863-109064885 CCCAGGAGGTGGAAGTCGCAGGG - Intronic
1060202684 9:121660961-121660983 CCCACGAAGGAGAAGTCCAGGGG + Intronic
1061164171 9:128912851-128912873 CGCTGGAGGGGGAATTCAAAGGG + Intronic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1062145582 9:134988008-134988030 CCCAGGGTGGGGAAGGCCAAGGG - Intergenic
1062276515 9:135733885-135733907 CCCAAGGTGGGGAAGACAAAAGG - Intronic
1062712394 9:137983666-137983688 ACCAGGGAGGGGAAGTTACAGGG + Intronic
1062724983 9:138067621-138067643 CCCAGGAGGTGGAGGTCACAGGG + Intronic
1186033214 X:5392278-5392300 AGCAGGAAGGGGAATTGAAAAGG + Intergenic
1187564000 X:20430333-20430355 CCCAGGAAAGGGATCTCCAAAGG + Intergenic
1189693676 X:43641907-43641929 ACCAGGAAGGCAAAGTAAAATGG - Intergenic
1189879072 X:45470654-45470676 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1189879159 X:45471287-45471309 CCCTGGAAGTGGAAGACAAAGGG - Intergenic
1189882673 X:45508578-45508600 CTCTGGAAGGGGAACTCAATAGG + Intergenic
1191007647 X:55727410-55727432 CCAAGGAGGGGGAAGTAAAGGGG + Intronic
1191767270 X:64711853-64711875 CACAGTAAGGGGAAATAAAAGGG + Intergenic
1192595693 X:72406044-72406066 ACCAGGAAGGAGAAGTCAACAGG - Intronic
1193062765 X:77223594-77223616 CCCAGGTAGTGAAAGACAAAGGG + Intergenic
1193317189 X:80077535-80077557 CCCAGGGAGGAGAAGCCAGATGG + Intergenic
1193578537 X:83232909-83232931 CCCTGGTAGTGGAAGACAAAGGG + Intergenic
1194206693 X:91019115-91019137 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic
1194409648 X:93542366-93542388 CCCAGGAAGAGAAAGTCAGGAGG + Intergenic
1194792795 X:98171722-98171744 CACAGGAAAGGGAAATCAAATGG - Intergenic
1195271512 X:103235772-103235794 CCCAGGAGGTGAAAGTCATAGGG + Intergenic
1195279023 X:103311113-103311135 CCCAGGCTGGGGATGTTAAAAGG - Intergenic
1195957565 X:110348839-110348861 CTAAGAAAGGGGAAGTAAAATGG + Intronic
1196051237 X:111307541-111307563 CCCTGAAAAGGGAAGTTAAATGG - Intronic
1196737512 X:118992586-118992608 CCCTGGTAGTGGAAGACAAAGGG + Intronic
1198802636 X:140462974-140462996 ACCAGGATGGGGAAGTAAGATGG - Intergenic
1199521488 X:148741215-148741237 CCCTGGTAGTGGAAGACAAAGGG - Intronic
1200136036 X:153875297-153875319 CCCAGGAGGGGAAAGAGAAATGG + Intronic
1200552441 Y:4593904-4593926 CTCAGGCAGTGGAAGTCAGAGGG + Intergenic