ID: 1006097046

View in Genome Browser
Species Human (GRCh38)
Location 6:31662507-31662529
Sequence CGGGGTCCCAGCCCCATTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006097033_1006097046 20 Left 1006097033 6:31662464-31662486 CCTCTTGAGGACAGTGGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 215
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243
1006097032_1006097046 21 Left 1006097032 6:31662463-31662485 CCCTCTTGAGGACAGTGGGGATG 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243
1006097028_1006097046 27 Left 1006097028 6:31662457-31662479 CCTGGTCCCTCTTGAGGACAGTG 0: 1
1: 0
2: 2
3: 12
4: 144
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006097046 Original CRISPR CGGGGTCCCAGCCCCATTCC TGG Exonic
900283945 1:1890580-1890602 CGGGGTCCCAGGCCCAAGGCTGG - Intronic
900596918 1:3484112-3484134 CGGGGTCCCAGGGCCAGCCCTGG - Intergenic
900951872 1:5862637-5862659 CGGGGTCTCAGCCCCCACCCAGG + Intergenic
901232583 1:7649463-7649485 GTGGGTCCCAGCCCTCTTCCTGG + Intronic
901380691 1:8871837-8871859 CCTGCTTCCAGCCCCATTCCTGG - Intronic
901703871 1:11059611-11059633 CGCAGTCCCAGCCCCAGCCCAGG + Intronic
901805633 1:11736637-11736659 CCGGGTCCCAGCACCGTTTCAGG + Intronic
902637361 1:17743385-17743407 CGCGGTCCCTGCCCCATGGCTGG - Intergenic
902825911 1:18974150-18974172 GGGGGTCCCAGGGCCATGCCAGG + Intergenic
903764867 1:25727690-25727712 TGGGGTCTCAGCCCCAGTTCTGG + Intronic
903846494 1:26282351-26282373 CCCGGTCCCGGCCCCAGTCCCGG - Exonic
903846506 1:26282375-26282397 CCCGGTCCCGGCCCCAGTCCCGG - Exonic
905277750 1:36829889-36829911 CACAGTCCCAACCCCATTCCTGG - Intronic
905875903 1:41431998-41432020 CAAGGGGCCAGCCCCATTCCTGG + Intergenic
906805564 1:48776552-48776574 CGGGGTCCCAGCCCCCGCCCGGG + Intronic
907053352 1:51344493-51344515 CTGGGTTCCAGTCCCAGTCCAGG - Intronic
912363096 1:109111175-109111197 ATGGGTCCCAGCCCCATAGCAGG - Intronic
914052279 1:144146205-144146227 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
914126918 1:144820336-144820358 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
914942749 1:152037083-152037105 CGCGGTCCCAGGCCCAGCCCGGG - Intronic
915217408 1:154349353-154349375 CGGGGAGCCAGCCCCACTCGGGG + Exonic
915320177 1:155052007-155052029 TGGTGTCCCAGCCTCTTTCCTGG - Intronic
915934367 1:160082127-160082149 CGGGGTTCCTTCCCCATCCCTGG + Intronic
916059577 1:161089434-161089456 AGGGGACCCAGCCCCAGCCCCGG + Exonic
917445933 1:175105857-175105879 CAGGGTCCCAGGACCATTGCAGG - Intronic
920100427 1:203513868-203513890 GGGAAACCCAGCCCCATTCCTGG - Intergenic
1062904408 10:1170123-1170145 TGGGGCCCCAGCTCAATTCCAGG - Intergenic
1062958068 10:1553062-1553084 CGGAGACCCTGCCCCATTGCTGG + Intronic
1063007444 10:1987103-1987125 CAGGGGCCCACCACCATTCCTGG + Intergenic
1064049959 10:12051597-12051619 TGAGGTCCCAGCCCCCATCCGGG + Intergenic
1064177171 10:13085193-13085215 CTGGGTCCCAGCCCCAGCCAAGG + Intronic
1064209148 10:13348297-13348319 CGGCGCCCCCGCCCCCTTCCCGG - Exonic
1064552758 10:16520385-16520407 CGGGCTCCCACCCCCATTTCCGG + Intronic
1065813889 10:29467380-29467402 CGGGGACCAAGCCACCTTCCAGG - Intronic
1074316346 10:112364821-112364843 AGGGCTCACAGCTCCATTCCGGG + Intergenic
1076175142 10:128362594-128362616 CGGGGTCTCAGACAGATTCCTGG + Intergenic
1076582312 10:131520048-131520070 CAGGGTCCCCGCCCCGCTCCTGG - Intergenic
1076683606 10:132187144-132187166 CGGCGTCCAGGCCCCACTCCGGG - Intronic
1076835990 10:133021204-133021226 CGCGGTCCCGGCCCCAGCCCTGG + Intergenic
1076887127 10:133268018-133268040 CGGGGCTCCAGCCCCATCCAGGG - Exonic
1077088529 11:766884-766906 CAGGGACACAGCCCCATGCCCGG - Intergenic
1077304500 11:1863046-1863068 CTGGGTCCCAGGGCCAGTCCTGG - Intronic
1077333295 11:1992838-1992860 CGGGCTCCCAGCCCCCGCCCCGG + Intergenic
1077485083 11:2834897-2834919 CTGGAATCCAGCCCCATTCCTGG - Intronic
1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG + Intronic
1081634527 11:44712094-44712116 CCGGCTCCCAGCCCTACTCCAGG + Intergenic
1081773992 11:45665480-45665502 CCGGGTCCCGGCCCCTGTCCCGG - Exonic
1082089463 11:48077539-48077561 CTGTGTCTCAGCACCATTCCAGG + Intronic
1082693416 11:56331941-56331963 CGGGGTCCCAGGCCAGTTACTGG + Intergenic
1083933103 11:65856837-65856859 CTGGGGCCTAGCACCATTCCCGG - Intronic
1084606740 11:70176870-70176892 GGGGCTCCCAGCCCCACCCCAGG + Intronic
1084972297 11:72778555-72778577 CAGGGTCCCAGCCTCCTTCCTGG + Intronic
1202816275 11_KI270721v1_random:48019-48041 CGGGCTCCCAGCCCCCGCCCCGG + Intergenic
1091558001 12:1590351-1590373 CTGGGTTCCAGCCCTCTTCCTGG + Intronic
1092256725 12:6929982-6930004 TGGGCTCCCAGGCCCATCCCAGG + Intronic
1094481328 12:30884537-30884559 TGGGGTCCCAGCAGAATTCCTGG - Intergenic
1094609136 12:31976538-31976560 CAGGGTCCCACCACCATGCCAGG - Intronic
1096252828 12:50044365-50044387 CAATGTTCCAGCCCCATTCCAGG + Intergenic
1096571237 12:52524492-52524514 CAGGGTCCCAGACCCATCCAAGG - Intergenic
1096620981 12:52865435-52865457 CCAGGGCCCAGACCCATTCCCGG + Intergenic
1102968862 12:117149977-117149999 GGTGCTCCCAGCCCCACTCCTGG + Intronic
1103096473 12:118136488-118136510 CGGGGTCCATGTCCCATGCCTGG + Intronic
1103564726 12:121809965-121809987 CGGGGCCACAGCCGCTTTCCGGG + Exonic
1104995452 12:132651622-132651644 CCGGGTCCCACCCCCACTCAGGG - Intronic
1108147842 13:47498467-47498489 CAGGGTTCCAGCCCCATCACAGG + Intergenic
1112368503 13:98774947-98774969 CTGGGGCCCAGCCCCATGCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1115525565 14:34277116-34277138 CTGGGTCTCATGCCCATTCCTGG - Intronic
1117496316 14:56309074-56309096 GGGGGTCCCAGCAGCATGCCTGG - Intergenic
1119322209 14:73738911-73738933 CTGGGTGCCAGCCCCATCCAGGG + Exonic
1121457017 14:94044790-94044812 TGGGGTCTCAGCCCCAGCCCTGG + Intronic
1121473796 14:94175335-94175357 CTGGGTCCCAGCTACAGTCCTGG - Intronic
1122615017 14:103011219-103011241 AGGGCTCCCAGCCCCATACAAGG + Intronic
1122791905 14:104187548-104187570 CAGGGTCACAGCCCCGTGCCAGG + Intergenic
1122921979 14:104884117-104884139 CAGTGTCCCAGCCCCAGTCCAGG + Exonic
1123421937 15:20142183-20142205 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
1123531165 15:21148723-21148745 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
1124340236 15:28885783-28885805 CTGGGTCCCAGCCCCGATCCCGG + Intronic
1124343266 15:28903587-28903609 CGGGGTCCCCGCCCATTTACAGG - Intronic
1124841864 15:33249607-33249629 CTGGATGCCAGCCCCAATCCTGG + Intergenic
1125605162 15:40936151-40936173 GGGGGTGGGAGCCCCATTCCAGG - Intronic
1129461956 15:75704093-75704115 CTGCTTCTCAGCCCCATTCCAGG + Intronic
1129465588 15:75722612-75722634 GGGGGTCCCAGCCCCAGATCCGG + Intergenic
1129722898 15:77887752-77887774 CTGCTTCTCAGCCCCATTCCAGG - Intergenic
1130243433 15:82220316-82220338 ATTGGTCCCAGCTCCATTCCAGG + Intronic
1130457035 15:84120964-84120986 ATTGGTCCCAGCTCCATTCCAGG - Intergenic
1131537835 15:93252378-93252400 CGGGCTCCCACCCCGCTTCCAGG + Intergenic
1132284972 15:100656432-100656454 CAGCCTCCCAGCCCCATCCCTGG + Intergenic
1132689459 16:1176005-1176027 CTGGGTCCCAACCCCGTTCGTGG + Intronic
1133220396 16:4316989-4317011 CTGGATTCCAGCCCCATCCCAGG - Intronic
1136233649 16:28902262-28902284 CGGGCTCCCAGCCACAGCCCTGG + Exonic
1136285200 16:29236621-29236643 CGTGGTCCCGGCCCCTCTCCTGG + Intergenic
1138492463 16:57384359-57384381 CCATGTCCCAGCCCCCTTCCCGG - Exonic
1138529109 16:57625443-57625465 GGGTGTCCCAGCCCTTTTCCTGG + Intronic
1138580570 16:57938256-57938278 TGGGGACCCAGCCCCAGGCCTGG + Intronic
1139358654 16:66382689-66382711 CGGAGACCCAGCCCCATGCCAGG - Intronic
1142090266 16:88206246-88206268 CGTGGTCCCGGCCCCTCTCCTGG + Intergenic
1142263986 16:89055220-89055242 AGGGGTCCCAGCCCCACAGCTGG - Intergenic
1142329558 16:89442707-89442729 CTGGGTTCCAGCAACATTCCTGG - Intronic
1142367479 16:89657699-89657721 CGGGGTCGCCGCCCCACTTCCGG + Exonic
1142731339 17:1860271-1860293 TGCCGTCCCAGCCCCAGTCCAGG - Intronic
1142848317 17:2692524-2692546 CAGGGACCCAGCTCCATCCCAGG - Intronic
1143527654 17:7481897-7481919 CAGGGTCCCAGACCCCATCCTGG + Intronic
1144623329 17:16832027-16832049 CAGGGTAACAGCCCCAGTCCGGG + Intergenic
1144883102 17:18440689-18440711 CAGGGTAACAGCCCCAGTCCGGG - Intergenic
1145149128 17:20503697-20503719 CAGGGTAACAGCCCCAGTCCGGG + Intergenic
1146929712 17:36768527-36768549 TGGGGTCCCCGCCCCAGGCCTGG + Intergenic
1148466160 17:47866438-47866460 CTGGCTCCCAGCCCCTTCCCAGG - Intergenic
1148754215 17:49964141-49964163 CGGTGTCCCAGCCCCGGACCCGG - Intergenic
1150054170 17:61996548-61996570 ATGGGTTCCAGACCCATTCCTGG + Intronic
1151477684 17:74353125-74353147 CGAGGTCCCACCCCCACCCCAGG - Intronic
1151728243 17:75896681-75896703 CGGGATCCCGGCCCCGATCCCGG - Exonic
1152546740 17:81004098-81004120 GGGGGTGCGAGCCCCACTCCCGG - Intronic
1154176843 18:12091638-12091660 CCTGGCCCCAGCCCCCTTCCCGG - Intergenic
1154202231 18:12307892-12307914 CGGGGTCCCAGCGCCGCGCCCGG - Intronic
1154437417 18:14357577-14357599 CACTGTCCCCGCCCCATTCCTGG + Intergenic
1156888303 18:42160965-42160987 CTGGGGCCCAGCCCCATGCTAGG + Intergenic
1157569956 18:48705685-48705707 CAGGGGCCCAGCCCAACTCCCGG + Intronic
1158893738 18:61894761-61894783 CGCGGCCCCGGCCCCCTTCCCGG - Intergenic
1161102772 19:2429483-2429505 GGGGGCCCCAGCCCCAGGCCGGG - Exonic
1161273230 19:3401670-3401692 CAGGGTCCCAGCCCTAACCCAGG + Intronic
1161716826 19:5880849-5880871 CGGGGCCCCAGCCTCCCTCCTGG - Intronic
1162099938 19:8333517-8333539 CCCGGCCCCAGCCCCACTCCCGG - Intronic
1162301512 19:9847600-9847622 CGGGGGGCCAGCCCCCTGCCTGG + Intronic
1162398868 19:10432692-10432714 TGGGGCCCCACCCCCTTTCCTGG + Intronic
1163548378 19:17952162-17952184 CGGGGTCCGCGCCCCCTCCCCGG + Intronic
1163630354 19:18415264-18415286 GGGGGCGCCAGCCCCAGTCCTGG + Intergenic
1165603470 19:37078509-37078531 CGGGTTCCAAGCCCAATTTCGGG - Exonic
1166365887 19:42278265-42278287 AGATGTCTCAGCCCCATTCCTGG + Intronic
1166706384 19:44910213-44910235 CGGGCTCGGAGCCCCATGCCTGG - Intergenic
1167494078 19:49807835-49807857 TGGGGTCACAGCGCCATCCCAGG + Intronic
1202691676 1_KI270712v1_random:98629-98651 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
925160694 2:1681482-1681504 CGGGATCCCATCCCCATCTCGGG - Intronic
925185079 2:1841734-1841756 CAGCCTCCCAGCCCCATTCTTGG + Intronic
925368514 2:3327101-3327123 CGGGGTCCCACCCCATCTCCCGG - Intronic
925607535 2:5673713-5673735 CGGGCTCCCAGCCACCTGCCTGG - Intergenic
926225266 2:10962406-10962428 CGAGGTCCCAGCACCACTGCTGG + Intergenic
928756729 2:34535245-34535267 CAGGGTCCTGGTCCCATTCCTGG + Intergenic
929548855 2:42876191-42876213 TGGGGTCCCAGCCCCATCCTTGG + Intergenic
930220007 2:48736539-48736561 AGGGGCCCAAGCCCCAATCCTGG - Intronic
930876857 2:56228673-56228695 CAGGGGCCCACCCCCATGCCTGG + Intronic
931649294 2:64454147-64454169 CCGGGTCCCCGCCCTGTTCCCGG + Exonic
932028423 2:68158138-68158160 TAGGGTCCCAGCCACATACCAGG - Exonic
932463108 2:71896025-71896047 CAGGGCCCCAGCCCCACACCTGG + Intergenic
933954712 2:87355321-87355343 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
934238909 2:90251547-90251569 CCTGGCCCCAGCCCCATTGCTGG + Intergenic
934274286 2:91565163-91565185 CCTGGCCCCAGCCCCATTGCTGG - Intergenic
934613335 2:95756393-95756415 AGGCATCCCAGGCCCATTCCCGG + Intergenic
934647562 2:96068027-96068049 AGGCGTCCCAGGCCCATTCCCGG - Intergenic
934840937 2:97623847-97623869 AGGCGTCCCAGACCCATTCCCGG - Intergenic
944985029 2:205166777-205166799 CTGGGGTCCAGCCCTATTCCAGG + Intronic
945978224 2:216287111-216287133 CCAGGTCCCACCCCAATTCCTGG + Intronic
946037649 2:216756498-216756520 CTGTGTCCCAGCCCCAACCCAGG - Intergenic
948580832 2:238986371-238986393 CAGGGTCCCAGCCCCAGGGCAGG + Intergenic
948809234 2:240466429-240466451 AGAGGTCCCAGCCCCAGGCCTGG + Exonic
948869723 2:240791929-240791951 GGGGGTCCCAGCCCCAGTGCAGG - Intronic
1169139901 20:3221867-3221889 AGGGGTCCCAGCCAAAGTCCTGG - Exonic
1171417503 20:24992891-24992913 CGGGTTCCGAGCCCCACTTCCGG - Exonic
1173216421 20:41089165-41089187 CAGGCTCCCACCACCATTCCCGG + Intronic
1175875420 20:62227302-62227324 GGGGGACCCAGCCCCAGCCCAGG + Intergenic
1175915132 20:62422618-62422640 CCGGGCCCCATCCCCACTCCGGG - Intronic
1176111449 20:63412638-63412660 GGGGGTCACAGCCCAACTCCGGG - Intronic
1176195466 20:63834815-63834837 AGGGGACCCAGCCCCATTCCAGG + Intergenic
1176839635 21:13828061-13828083 CACTGTCCCTGCCCCATTCCTGG - Intergenic
1179138235 21:38699317-38699339 GGTGGTCCCAGCACCTTTCCAGG - Intergenic
1179511209 21:41875074-41875096 CAGGGTCCCTGCCCAATCCCAGG + Intronic
1179637551 21:42723098-42723120 TGGGCTGCCAGCCTCATTCCTGG - Intronic
1179717642 21:43298012-43298034 CAGGGTGCCAGCCCCCTCCCAGG - Intergenic
1179822595 21:43945227-43945249 CGGGGTCCCAGGGTCATCCCGGG + Intronic
1179922596 21:44515313-44515335 CGTGGTCCCAGCGCCTTCCCAGG + Intronic
1180109193 21:45640104-45640126 CAGGGTCCCAGGCCCAGGCCAGG + Intergenic
1180172619 21:46067676-46067698 CGTGCTCCCAGCTCCGTTCCTGG - Intergenic
1180252446 21:46598116-46598138 TGGGCCACCAGCCCCATTCCCGG - Intergenic
1181026493 22:20130723-20130745 CTGGGTCCCGGCCCCAGTCCTGG + Intronic
1181125969 22:20702722-20702744 CCTGGGTCCAGCCCCATTCCAGG - Intergenic
1181239306 22:21468030-21468052 CCTGGGTCCAGCCCCATTCCAGG - Intergenic
1183306405 22:37085459-37085481 CAGGGTCCCAGCCCTCTTCTCGG - Intronic
1183437749 22:37805124-37805146 CGGCGGCGCAGCGCCATTCCGGG + Exonic
1183505272 22:38205292-38205314 TGGGGTTCCAGCCCCAGTTCAGG - Intronic
1183688335 22:39374720-39374742 TGGGGTCCCAGGCCCTGTCCTGG - Intronic
1184504527 22:44892936-44892958 CGGATTCCCACCCCCATCCCTGG + Intronic
1184825330 22:46946749-46946771 AGGGGCCCCAGGCTCATTCCAGG - Intronic
950450703 3:13063565-13063587 CGGGGCCCCAGCCCCAGCCCAGG - Intronic
950604383 3:14065097-14065119 CCCAATCCCAGCCCCATTCCAGG + Exonic
950722955 3:14897910-14897932 CACTGTCCCATCCCCATTCCTGG + Intronic
954404515 3:50337928-50337950 CGGGTTCCCAGCCCAGGTCCCGG + Exonic
955378741 3:58419739-58419761 CCGTTTCCCAGCCCCTTTCCAGG + Intronic
956691837 3:71885712-71885734 TGGGGATCCACCCCCATTCCTGG - Intergenic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
968506363 4:973086-973108 CGGGGTCCCAGCCCTGCTCGCGG - Intronic
969442449 4:7225543-7225565 CCCGGTCCCAGCCCCTTCCCAGG - Intronic
972813882 4:42622237-42622259 CAGGCTCCCACCACCATTCCCGG - Intronic
976442328 4:85089458-85089480 CCAGGGCCCAGCCCCACTCCTGG - Intergenic
978618046 4:110615060-110615082 CGGGGTTCCTGCCCCAGGCCTGG + Intergenic
979327983 4:119401213-119401235 CAGGTTCCCACCACCATTCCTGG + Intergenic
981413623 4:144462296-144462318 CTGGGTGCCAGCTCCTTTCCAGG - Intergenic
984814801 4:183826109-183826131 CAGGTCCCCAGCCCCACTCCTGG - Intergenic
987781504 5:22442360-22442382 CAGGCTCCCACCACCATTCCTGG - Intronic
996467156 5:123816220-123816242 CCGGGTACCATGCCCATTCCTGG - Intergenic
997198192 5:131993662-131993684 CTGGGTCCCAGCACCAGACCAGG + Intronic
998131979 5:139655896-139655918 GGGCGTCCCAGCCACATTCCTGG - Intronic
999178121 5:149646562-149646584 TGGGGCCTCAGCCCCATTTCTGG + Intergenic
999286304 5:150396330-150396352 GGGGTTCCCAGCCCCTTTCTTGG - Exonic
1001941213 5:175741038-175741060 CGGGGTCCCTGGGCCATTCAGGG - Intergenic
1003976889 6:11353075-11353097 CGGGGTCCCAGGCTCTTTCTGGG + Intronic
1004426233 6:15509136-15509158 CGGGGACCCAGCCTCAATCAGGG - Intronic
1005882098 6:30069675-30069697 CAGGGTCCCAGTCAGATTCCAGG + Exonic
1006096335 6:31659058-31659080 CACGGTCACAGCCCCTTTCCCGG + Exonic
1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG + Exonic
1006133655 6:31883195-31883217 CGCTGTCCCAGCCACATCCCAGG + Intronic
1006823796 6:36918782-36918804 CCTGGTCCCAGCCCCACCCCAGG + Intronic
1007236080 6:40392252-40392274 CGACGTCCCAGCCCCTCTCCCGG + Exonic
1008593439 6:53017235-53017257 CCAGGTCCCAGCACCATTGCTGG - Intronic
1013189082 6:107786693-107786715 CAGTGTCCCAGCCCTCTTCCAGG + Intronic
1015477673 6:133671676-133671698 CCAGGCCCCAGCTCCATTCCTGG + Intergenic
1016029909 6:139326552-139326574 AGGGGTCCTGCCCCCATTCCTGG + Intergenic
1016055895 6:139577536-139577558 CAGGGGTCCAGCCCCATGCCTGG - Intergenic
1017772174 6:157651934-157651956 CCAGGTCCCAGCCCCATCCCTGG + Intronic
1018085786 6:160300268-160300290 CCGGGGCCCAGCACCATGCCCGG - Intergenic
1019308596 7:347962-347984 AGGGGCCCCAGCTCCATCCCAGG + Intergenic
1019344320 7:522050-522072 GGGGGTCCCAGTCCCACGCCGGG - Intergenic
1019557513 7:1640046-1640068 CTGGGTGCCAGACCCCTTCCTGG - Intergenic
1019712940 7:2525615-2525637 CACGGTCCCACCCCCACTCCGGG - Intronic
1022254469 7:28642067-28642089 CGGGGTTCCAGCACAATTGCTGG - Intronic
1030056765 7:105589935-105589957 CAATGTCCCAGCCCCATCCCAGG - Intronic
1031918922 7:127587782-127587804 CGGGGTCACAGACCCACTCCTGG - Intronic
1032197316 7:129796766-129796788 CCAGGTCCTAGCCCCTTTCCTGG - Intergenic
1032227594 7:130045746-130045768 CAGGCTCCCACCACCATTCCTGG - Intronic
1033245487 7:139713824-139713846 CCGGGTACCAGCCCCATTGGGGG - Intronic
1039566331 8:38554731-38554753 TGGGGTCCCAGACACATTCGGGG - Intergenic
1039911940 8:41833151-41833173 CGAGGCCCCAGGCCCATCCCGGG + Intronic
1045364710 8:101464916-101464938 CAGGTTCCCAGCACCACTCCTGG - Intergenic
1048524423 8:135188177-135188199 CTGGAGCCCAGCCCCATGCCTGG - Intergenic
1049354332 8:142180107-142180129 CCGAGTCCCAGGCCCATTCCCGG - Intergenic
1049828380 8:144685023-144685045 CGGGGCACCGGCCGCATTCCCGG - Intergenic
1049832375 8:144710157-144710179 CAGGGTTCCAACCCCAGTCCTGG + Intergenic
1053129156 9:35605523-35605545 CGCGGGCCCAGCCCGATCCCGGG - Exonic
1056834603 9:89944443-89944465 CCAGGTCCCAGGCCCATGCCAGG + Intergenic
1057169844 9:92955126-92955148 CAGCCTCCCAGCCTCATTCCTGG - Intronic
1059346952 9:113635567-113635589 CAAAGTCCCAGACCCATTCCAGG + Intergenic
1060187757 9:121574352-121574374 TGGCGTCCCTTCCCCATTCCAGG - Intronic
1060547599 9:124470244-124470266 TGGGGTCCCAGCCCCCAACCTGG - Intronic
1061159280 9:128883829-128883851 CGGGTGCGCAGCCCCATGCCTGG - Intronic
1061478382 9:130884275-130884297 GGGGACCCCAGCCCCATTGCTGG - Exonic
1061679428 9:132235736-132235758 CGGGGTCTCAGGCCCATCACAGG - Intronic
1061755440 9:132809143-132809165 CTGGGTGCCAGCGGCATTCCTGG - Intronic
1062076414 9:134592443-134592465 CGGGCTCCCTGCCCCCTCCCAGG + Intergenic
1062151310 9:135020593-135020615 AGGGGTCCCAGCTTCAGTCCTGG + Intergenic
1062197838 9:135284550-135284572 CAGGGTCCCAGCCACAGCCCTGG - Intergenic
1062466608 9:136684427-136684449 CGTGGTCTCAGCCCCAAGCCCGG + Intronic
1062567922 9:137171470-137171492 CGGGGGCCCAGCACTGTTCCAGG - Intronic
1203697082 Un_GL000214v1:109010-109032 CCGGCCCTCAGCCCCATTCCCGG - Intergenic
1185478837 X:431072-431094 GGGGGTCACTGCCCCCTTCCTGG + Intergenic
1187290624 X:17949986-17950008 CGGCGTCTCACCCCCCTTCCTGG + Intergenic
1188486686 X:30689700-30689722 CTGGGGCCCAGACCCATTCCTGG + Intronic
1192188089 X:68969466-68969488 CGGGTGCCCACCACCATTCCTGG + Intergenic
1192436206 X:71145238-71145260 AGGGCCCCCAGCCCCATCCCGGG + Intronic
1195094631 X:101492221-101492243 CTGGTTCTCAGCCCCAGTCCAGG - Exonic
1195520022 X:105820210-105820232 TCGGGTCACAGCCCCATGCCTGG + Intergenic
1200002497 X:153069277-153069299 CGGGCTCCCAGCCTCAACCCTGG - Intergenic
1200005227 X:153080733-153080755 CGGGCTCCCAGCCTCAACCCTGG + Intergenic
1200163052 X:154019050-154019072 CAGGCTCCCAGACCCATTCAGGG - Exonic
1200316076 X:155134506-155134528 TGGGTTCCCAGATCCATTCCAGG - Intronic
1201286941 Y:12387305-12387327 CGGGGTGCCATCCCCATCCTTGG - Intergenic