ID: 1006097046

View in Genome Browser
Species Human (GRCh38)
Location 6:31662507-31662529
Sequence CGGGGTCCCAGCCCCATTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006097032_1006097046 21 Left 1006097032 6:31662463-31662485 CCCTCTTGAGGACAGTGGGGATG 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243
1006097028_1006097046 27 Left 1006097028 6:31662457-31662479 CCTGGTCCCTCTTGAGGACAGTG 0: 1
1: 0
2: 2
3: 12
4: 144
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243
1006097033_1006097046 20 Left 1006097033 6:31662464-31662486 CCTCTTGAGGACAGTGGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 215
Right 1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG 0: 1
1: 0
2: 2
3: 18
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006097046 Original CRISPR CGGGGTCCCAGCCCCATTCC TGG Exonic