ID: 1006100759

View in Genome Browser
Species Human (GRCh38)
Location 6:31684729-31684751
Sequence CCTTAAATGCAAAGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006100759_1006100764 13 Left 1006100759 6:31684729-31684751 CCAGCTCCTCTTTGCATTTAAGG No data
Right 1006100764 6:31684765-31684787 TGAACAAAAATTTAGTTTTCAGG No data
1006100759_1006100766 15 Left 1006100759 6:31684729-31684751 CCAGCTCCTCTTTGCATTTAAGG No data
Right 1006100766 6:31684767-31684789 AACAAAAATTTAGTTTTCAGGGG No data
1006100759_1006100765 14 Left 1006100759 6:31684729-31684751 CCAGCTCCTCTTTGCATTTAAGG No data
Right 1006100765 6:31684766-31684788 GAACAAAAATTTAGTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006100759 Original CRISPR CCTTAAATGCAAAGAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr